Gene Page:PHKG2

Summary?
GeneID 5261
Symbol PHKG2
Synonyms GSD9C
Description phosphorylase kinase, gamma 2 (testis)
Reference MIM:172471|HGNC:HGNC:8931|Ensembl:ENSG00000156873|HPRD:01405|Vega:OTTHUMG00000132400
Gene type protein-coding
Map location 16p11.2
Pascal p-value 0.034
Sherlock p-value 0.008
Fetal beta -0.633
DMG 1 (# studies)

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
GSMA_IIE Genome scan meta-analysis (European-ancestry samples) Psr: 0.01775

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg02091607 16 30760815 PHKG2 5.49E-4 0.282 0.049 DMG:Wockner_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception我们eks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
CABLES2 0.91 0.94
PTPRS 0.90 0.93
USP22 0.90 0.93
C17orf63 0.89 0.91
ARID1B 0.89 0.91
PHF12 0.89 0.90
FOXK2 0.89 0.92
ZNF142 0.89 0.91
YTHDF1 0.89 0.92
TGFBRAP1 0.88 0.93
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.31 -0.71 -0.82
MT-CO2 -0.69 -0.83
AF347015.27 -0.68 -0.80
C5orf53 -0.66 -0.71
MT-CYB -0.66 -0.78
FXYD1 -0.66 -0.77
AF347015.33 -0.66 -0.75
IFI27 -0.66 -0.77
AF347015.8 -0.66 -0.80
HIGD1B -0.66 -0.80

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0000166 nucleotide binding IEA -
GO:0005516 calmodulin binding IEA -
GO:0005524 ATP binding IEA -
GO:0005524 ATP binding NAS -
GO:0004672 protein kinase activity IEA -
GO:0004674 protein serine/threonine kinase activity NAS -
GO:0004689 phosphorylase kinase activity NAS 8020963
GO:0004689 phosphorylase kinase activity TAS 2948189
GO:0016740 transferase activity IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006468 protein amino acid phosphorylation IEA -
GO:0006468 protein amino acid phosphorylation NAS -
GO:0006091 generation of precursor metabolites and energy TAS 8896567
GO:0005978 glycogen biosynthetic process IEA -
GO:0005975 carbohydrate metabolic process IEA -
GO:0008150 biological_process ND -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005575 cellular_component ND -
GO:0005964 phosphorylase kinase complex IEA -
GO:0005964 phosphorylase kinase complex NAS 8020963

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG CALCIUM SIGNALING PATHWAY 178 134 All SZGR 2.0 genes in this pathway
KEGG INSULIN SIGNALING PATHWAY 137 103 All SZGR 2.0 genes in this pathway
REACTOME GLYCOGEN BREAKDOWN GLYCOGENOLYSIS 18 10 All SZGR 2.0 genes in this pathway
REACTOME METABOLISM OF CARBOHYDRATES 247 154 All SZGR 2.0 genes in this pathway
REACTOME GLUCOSE METABOLISM 69 42 All SZGR 2.0 genes in this pathway
PARENT MTOR SIGNALING UP 567 375 All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN 335 193 All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE UP 530 342 All SZGR 2.0 genes in this pathway
CONCANNON APOPTOSIS BY EPOXOMICIN UP 239 157 All SZGR 2.0 genes in this pathway
MOHANKUMAR TLX1 TARGETS UP 414 287 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN 514 330 All SZGR 2.0 genes in this pathway
SU TESTIS 76 53 All SZGR 2.0 genes in this pathway
LEE CALORIE RESTRICTION NEOCORTEX DN 88 58 All SZGR 2.0 genes in this pathway
WELCSH BRCA1 TARGETS DN 141 92 All SZGR 2.0 genes in this pathway
RIZKI TUMOR INVASIVENESS 3D DN 270 181 All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3 718 401 All SZGR 2.0 genes in this pathway
MIKKELSEN NPC ICP WITH H3K4ME3 445 257 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-1/206 57 63 1A hsa-miR-1 UGGAAUGUAAAGAAGUAUGUA
hsa-miR-206SZ UGGAAUGUAAGGAAGUGUGUGG
hsa-miR-613 AGGAAUGUUCCUUCUUUGCC