Gene Page:PIN1
Summary?
GeneID | 5300 |
Symbol | PIN1 |
Synonyms | DOD|UBL5 |
Description | peptidylprolyl cis/trans isomerase, NIMA-interacting 1 |
Reference | MIM:601052|HGNC:HGNC:8988|Ensembl:ENSG00000127445|HPRD:03031|Vega:OTTHUMG00000180388 |
Gene type | protein-coding |
Map location | 19p13 |
Pascal p-value | 0.228 |
Sherlock p-value | 0.23 |
Fetal beta | -1.568 |
DMG | 2 (# studies) |
Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 2 |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0573 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg04699474 | 19 | 9945708 | PIN1 | 2.24E-5 | -0.307 | 0.017 | DMG:Wockner_2014 |
cg22728790 | 19 | 9945653 | PIN1 | 1.08E-7 | -0.007 | 2.34E-5 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/PIN1_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
PTPN3 | 0.87 | 0.59 |
PTPN4 | 0.86 | 0.81 |
AKAP2 | 0.85 | 0.74 |
MCF2 | 0.85 | 0.62 |
FAM19A4 | 0.84 | 0.33 |
RORA | 0.84 | 0.47 |
EPN3 | 0.84 | 0.45 |
RASSF3 | 0.84 | 0.49 |
CHRNA3 | 0.83 | 0.53 |
SLC17A6 | 0.83 | 0.69 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
C16orf74 | -0.32 | -0.53 |
RGS20 | -0.32 | -0.48 |
C1orf61 | -0.31 | -0.61 |
CXCL14 | -0.31 | -0.48 |
OAF | -0.31 | -0.47 |
CSAG1 | -0.30 | -0.50 |
CLDN10 | -0.29 | -0.47 |
AF347015.21 | -0.29 | -0.54 |
EIF4EBP3 | -0.29 | -0.53 |
VAMP5 | -0.29 | -0.54 |
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003755 | peptidyl-prolyl cis-trans isomerase activity | IEA | - | |
GO:0005515 | protein binding | 新闻学会 | 11470801 | |
GO:0016853 | isomerase activity | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0006457 | protein folding | IEA | - | |
GO:0007049 | cell cycle | IEA | - | |
GO:0007088 | regulation of mitosis | TAS | 10391244 | |
GO:0042127 | regulation of cell proliferation | IEA | - | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | TAS | 8606777 |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
BCL2 | Bcl-2 | B-cell CLL/lymphoma 2 | - | HPRD | 11988841 |
BCL2 | Bcl-2 | B-cell CLL/lymphoma 2 | Affinity Capture-Western | BioGRID | 11326318 |
CCNB1 | CCNB | cyclin B1 | - | HPRD | 9499405 |
CCND1 | BCL1 | D11S287E | PRAD1 | U21B31 | cyclin D1 | PIN1 interacts with Cyclin D1. This interaction was modelled on a demonstrated interaction between human PIN1 and Cyclin D1 from an unspecified species. | BIND | 11805292 |
CDC2 | CDC28A | CDK1 | DKFZp686L20222 | MGC111195 | cell division cycle 2, G1 to S and G2 to M | - | HPRD | 11774038 |
CDC25C | CDC25 | cell division cycle 25 homolog C (S. pombe) | - | HPRD | 9482729|9499405 |10037602|9499405|10037602 |
CDC25C | CDC25 | cell division cycle 25 homolog C (S. pombe) | - | HPRD,BioGRID | 9499405|10037602 |
CDC27 | APC3 | CDC27Hs | D0S1430E | D17S978E | HNUC | cell division cycle 27 homolog (S. cerevisiae) | - | HPRD,BioGRID | 9499405|10939594 |
CDC27 | APC3 | CDC27Hs | D0S1430E | D17S978E | HNUC | cell division cycle 27 homolog (S. cerevisiae) | Pin1 interacts with Cdc27. | BIND | 9499405 |
CDK9 | C-2k | CDC2L4 | CTK1 | PITALRE | TAK | cyclin-dependent kinase 9 | - | HPRD | 11575923 |
CSNK2A1 | CK2A1 | CKII | casein kinase 2, alpha 1 polypeptide | - | HPRD,BioGRID | 11940573 |
CSNK2A2 | CK2A2 | CSNK2A1 | FLJ43934 | casein kinase 2, alpha prime polypeptide | - | HPRD,BioGRID | 11940573 |
CSNK2B | CK2B | CK2N | CSK2B | G5A | MGC138222 | MGC138224 | casein kinase 2, beta polypeptide | - | HPRD | 11940573 |
CTNNB1 | CTNNB | DKFZp686D02253 | FLJ25606 | FLJ37923 | catenin (cadherin-associated protein), beta 1, 88kDa | - | HPRD,BioGRID | 11533658 |
DAB2 | DOC-2 | DOC2 | FLJ26626 | disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila) | - | HPRD,BioGRID | 12881709 |
DDX24 | - | DEAD (Asp-Glu-Ala-Asp) box polypeptide 24 | Two-hybrid | BioGRID | 16169070 |
GGA2 | FLJ20966 | KIAA1080 | VEAR | golgi associated, gamma adaptin ear containing, ARF binding protein 2 | Two-hybrid | BioGRID | 16189514 |
GPAA1 | GAA1 | hGAA1 | glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast) | Two-hybrid | BioGRID | 16169070 |
HNRNPC | C1 | C2 | HNRNP | HNRPC | MGC104306 | MGC105117 | MGC117353 | MGC131677 | SNRPC | 异构核核糖核蛋白C (C1、C2) | Two-hybrid | BioGRID | 16189514 |
JUN | AP-1 | AP1 | c-Jun | jun oncogene | - | HPRD,BioGRID | 11432833 |
KIF20B | DKFZp434B0435 | DKFZp434P0810 | KRMP1 | MPHOSPH1 | MPP-1 | MPP1 | kinesin family member 20B | - | HPRD,BioGRID | 11470801 |
KLHL20 | KHLHX | KLEIP | KLHLX | RP3-383J4.3 | kelch-like 20 (Drosophila) | Two-hybrid | BioGRID | 16169070 |
LEPR | CD295 | OBR | leptin receptor | Two-hybrid | BioGRID | 16169070 |
MAPT | DDPAC | FLJ31424 | FTDP-17 | MAPTL | MGC138549 | MSTD | MTBT1 | MTBT2 | PPND | TAU | microtubule-associated protein tau | - | HPRD,BioGRID | 10391244 |
MDFI | I-MF | I-mfa | MyoD family inhibitor | Two-hybrid | BioGRID | 16189514 |
MYT1 | C20orf36 | MTF1 | MYTI | PLPB1 | myelin transcription factor 1 | Affinity Capture-Western Reconstituted Complex |
BioGRID | 10504341 |
NFATC2 | KIAA0611 | NFAT1 | NFATP | nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 | - | HPRD,BioGRID | 11356192 |
NONO | NMT55 | NRB54 | P54 | P54NRB | non-POU domain containing, octamer-binding | Two-hybrid | BioGRID | 16189514 |
PKMYT1 | DKFZp547K1610 | FLJ20093 | MYT1 | protein kinase, membrane associated tyrosine/threonine 1 | - | HPRD,BioGRID | 9499405|10504341 |
PKMYT1 | DKFZp547K1610 | FLJ20093 | MYT1 | protein kinase, membrane associated tyrosine/threonine 1 | Pin1 interacts with phosphorylated Myt1. | BIND | 10504341 |
PLK1 | PLK | STPK13 | polo-like kinase 1 (Drosophila) | - | HPRD,BioGRID | 9499405 |
PLK1 | PLK | STPK13 | polo-like kinase 1 (Drosophila) | Pin1 interacts with PLK1. | BIND | 9499405 |
POLR2A | MGC75453 | POLR2 | POLRA | RPB1 | RPBh1 | RPO2 | RPOL2 | RpIILS | hRPB220 | hsRPB1 | polymerase (RNA) II (DNA directed) polypeptide A, 220kDa | - | HPRD | 10932246 |
POLR2A | MGC75453 | POLR2 | POLRA | RPB1 | RPBh1 | RPO2 | RPOL2 | RpIILS | hRPB220 | hsRPB1 | polymerase (RNA) II (DNA directed) polypeptide A, 220kDa | Affinity Capture-Western | BioGRID | 10393805 |
PTOV1 | ACID2 | DKFZp586I111 | MGC71475 | prostate tumor overexpressed 1 | Two-hybrid | BioGRID | 16169070 |
PTPN1 | PTP1B | protein tyrosine phosphatase, non-receptor type 1 | - | HPRD | 9499405 |
RAB4A | HRES-1/RAB4 | RAB4 | RAB4A, member RAS oncogene family | - | HPRD,BioGRID | 10888662 |
RAF1 | CRAF | NS5 | Raf-1 | c-Raf | v-raf-1 murine leukemia viral oncogene homolog 1 | Raf-1 interacts with Pin1. This interaction was modelled on a demonstrated interaction between human Raf-1 and Pin1 from monkey and unspecified species. | BIND | 15664191 |
RAI1 | DKFZp434A139 | KIAA1820 | MGC12824 | SMCR | SMS | retinoic acid induced 1 | Two-hybrid | BioGRID | 16189514 |
RBBP8 | CTIP | RIM | retinoblastoma binding protein 8 | Two-hybrid | BioGRID | 16189514 |
RBPMS | HERMES | RNA binding protein with multiple splicing | Two-hybrid | BioGRID | 16189514 |
SFRS12 | DKFZp564B176 | MGC133045 | SRrp508 | SRrp86 | splicing factor, arginine/serine-rich 12 | - | HPRD | 14559993 |
SOCS3 | ATOD4 | CIS3 | Cish3 | MGC71791 | SOCS-3 | SSI-3 | SSI3 | 抑制细胞因子信号3 | Two-hybrid | BioGRID | 16169070 |
SUPT5H | FLJ34157 | SPT5 | SPT5H | suppressor of Ty 5 homolog (S. cerevisiae) | - | HPRD,BioGRID | 11575923 |
TOP2A | TOP2 | TP2A | topoisomerase (DNA) II alpha 170kDa | - | HPRD,BioGRID | 11940573 |
TP53 | FLJ92943 | LFS1 | TRP53 | p53 | tumor protein p53 | - | HPRD,BioGRID | 12388558|12397362 |
TP73 | P73 | tumor protein p73 | Pin1 interacts with phosphorylated p73-alpha | BIND | 15175157 |
TP73 | P73 | tumor protein p73 | Pin1 interacts with p73-beta. | BIND | 15175157 |
TRAF2 | MGC:45012 | TRAP | TRAP3 | TNF receptor-associated factor 2 | Two-hybrid | BioGRID | 16189514 |
TSC22D4 | THG-1 | THG1 | TSC22 domain family, member 4 | Two-hybrid | BioGRID | 16189514 |
VHL | HRCA1 | RCA1 | VHL1 | von Hippel-Lindau tumor suppressor | Affinity Capture-MS | BioGRID | 17353931 |
WEE1 | DKFZp686I18166 | FLJ16446 | WEE1A | WEE1hu | WEE1 homolog (S. pombe) | Affinity Capture-Western Far Western |
BioGRID | 9499405 |
ZCCHC10 | FLJ20094 | zinc finger, CCHC domain containing 10 | Two-hybrid | BioGRID | 16169070 |
ZMIZ2 | DKFZp761I2123 | KIAA1886 | ZIMP7 | hZIMP7 | zinc finger, MIZ-type containing 2 | Two-hybrid | BioGRID | 16189514 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG RIG I LIKE RECEPTOR SIGNALING PATHWAY | 71 | 51 | All SZGR 2.0 genes in this pathway |
BIOCARTA MPR PATHWAY | 34 | 28 | All SZGR 2.0 genes in this pathway |
ST WNT BETA CATENIN PATHWAY | 34 | 28 | All SZGR 2.0 genes in this pathway |
PID P73PATHWAY | 79 | 59 | All SZGR 2.0 genes in this pathway |
PID MYC PATHWAY | 25 | 22 | All SZGR 2.0 genes in this pathway |
PID PDGFRB PATHWAY | 129 | 103 | All SZGR 2.0 genes in this pathway |
PID P53 REGULATION PATHWAY | 59 | 50 | All SZGR 2.0 genes in this pathway |
REACTOME ANTIVIRAL MECHANISM BY IFN STIMULATED GENES | 66 | 45 | All SZGR 2.0 genes in this pathway |
REACTOME INTERFERON SIGNALING | 159 | 116 | All SZGR 2.0 genes in this pathway |
REACTOME NEGATIVE REGULATORS OF RIG I MDA5 SIGNALING | 31 | 19 | All SZGR 2.0 genes in this pathway |
REACTOME RIG I MDA5 MEDIATED INDUCTION OF IFN ALPHA BETA PATHWAYS | 73 | 57 | All SZGR 2.0 genes in this pathway |
REACTOME INNATE IMMUNE SYSTEM | 279 | 178 | All SZGR 2.0 genes in this pathway |
REACTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
REACTOME CYTOKINE SIGNALING IN IMMUNE SYSTEM | 270 | 204 | All SZGR 2.0 genes in this pathway |
DOANE RESPONSE TO ANDROGEN DN | 241 | 146 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 TARGETS DN | 260 | 143 | All SZGR 2.0 genes in this pathway |
BREUHAHN GROWTH FACTOR SIGNALING IN LIVER CANCER | 22 | 19 | All SZGR 2.0 genes in this pathway |
DAIRKEE TERT TARGETS UP | 380 | 213 | All SZGR 2.0 genes in this pathway |
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP | 479 | 299 | All SZGR 2.0 genes in this pathway |
NING CHRONIC OBSTRUCTIVE PULMONARY DISEASE DN | 121 | 79 | All SZGR 2.0 genes in this pathway |
MACLACHLAN BRCA1 TARGETS DN | 16 | 12 | All SZGR 2.0 genes in this pathway |
NATSUME RESPONSE TO INTERFERON BETA DN | 52 | 33 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 UP | 428 | 266 | All SZGR 2.0 genes in this pathway |
BILD E2F3 ONCOGENIC SIGNATURE | 246 | 153 | All SZGR 2.0 genes in this pathway |
ZHANG BREAST CANCER PROGENITORS UP | 425 | 253 | All SZGR 2.0 genes in this pathway |
MATZUK SPERMATOGONIA | 24 | 17 | All SZGR 2.0 genes in this pathway |
金ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
金BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
金ALL DISORDERS DURATION CORR DN | 146 | 90 | All SZGR 2.0 genes in this pathway |
KASLER HDAC7 TARGETS 1 UP | 194 | 133 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-200bc/429 | 111 | 117 | m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.