Gene Page:PKD1

Summary?
GeneID 5310
Symbol PKD1
Synonyms PBP|Pc-1|TRPP1
Description polycystin 1, transient receptor potential channel interacting
Reference MIM:601313|HGNC:HGNC:9008|Ensembl:ENSG00000008710|HPRD:03203|织女:OTTHUMG00000155795
Gene type protein-coding
Map location 16p13.3
Pascal p-value 0.176
Sherlock p-value 0.655
Fetal beta -0.278
DMG 1 (# studies)
eGene Myers' cis & trans
Support CompositeSet
Darnell FMRP targets
Ascano FMRP targets

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

探针 Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg21947488 16 2185289 PKD1 5.893E-4 0.364 0.05 DMG:Wockner_2014

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs16829545 chr2 151977407 PKD1 5310 4.783E-9 trans
rs3845734 chr2 171125572 PKD1 5310 7.946E-5 trans
rs7584986 chr2 184111432 PKD1 5310 4.967E-4 trans
rs4240295 chr4 115550111 PKD1 5310 0.15 trans
rs2183142 chr4 159232695 PKD1 5310 0.19 trans
rs9461864 chr6 33481468 PKD1 5310 0.18 trans
rs16955618 chr15 29937543 PKD1 5310 8.68E-13 trans
rs1041786 chr21 22617710 PKD1 5310 0.03 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0005529 sugar binding IEA -
GO:0005515 protein binding IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0007218 neuropeptide signaling pathway IEA Neurotransmitter (GO term level: 8) -
GO:0001568 blood vessel development IEA -
GO:0001502 cartilage condensation IEA -
GO:0007156 homophilic cell adhesion TAS 10861291
GO:0007259 JAK-STAT cascade IEA -
GO:0007161 calcium-independent cell-matrix adhesion TAS 10861291
GO:0007050 cell cycle arrest IEA -
GO:0009653 anatomical structure morphogenesis TAS 9326937
GO:0008150 biological_process ND -
GO:0007507 heart development IEA -
GO:0006816 calcium ion transport IEA -
GO:0050982 detection of mechanical stimulus IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005575 cellular_component ND -
GO:0005634 nucleus IEA -
GO:0016020 membrane IEA -
GO:0016021 integral to membrane IEA -
GO:0005929 cilium IEA -
GO:0005886 plasma membrane IEA -
GO:0005887 integral to plasma membrane TAS 7663510

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
BCAR1 CAS | CAS1 | CASS1 | CRKAS | P130Cas breast cancer anti-estrogen resistance 1 - HPRD 11113628
CDH1 Arc-1 | CD324 | CDHE | ECAD | LCAM | UVO cadherin 1, type 1, E-cadherin (epithelial) - HPRD 11274246
COL1A1 OI4 collagen, type I, alpha 1 Reconstituted Complex BioGRID 11752017
COL2A1 ANFH | AOM | COL11A3 | MGC131516 | SEDC collagen, type II, alpha 1 - HPRD,BioGRID 11406351
CTNNB1 CTNNB | DKFZp686D02253 | FLJ25606 | FLJ37923 catenin (cadherin-associated protein), beta 1, 88kDa Polycystin-1 interacts with beta-catenin. BIND 11113628
CTNNB1 CTNNB | DKFZp686D02253 | FLJ25606 | FLJ37923 catenin (cadherin-associated protein), beta 1, 88kDa - HPRD 11274246
FN1 CIG | DKFZp686F10164 | DKFZp686H0342 | DKFZp686I1370 | DKFZp686O13149 | ED-B | FINC | FN | FNZ | GFND | GFND2 | LETS | MSF fibronectin 1 - HPRD,BioGRID 11752017
JUP ARVD12 | CTNNG | DP3 | DPIII | PDGB | PKGB junction plakoglobin - HPRD 11274246
KRT18 CYK18 | K18 keratin 18 - HPRD,BioGRID 11581269
PKD2 APKD2 | MGC138466 | MGC138468 | PC2 | PKD4 polycystic kidney disease 2 (autosomal dominant) - HPRD,BioGRID 9192675
PKD2 APKD2 | MGC138466 | MGC138468 | PC2 | PKD4 polycystic kidney disease 2 (autosomal dominant) PKD1 interacts with PKD2. BIND 15692563
PTK2 FADK | FAK | FAK1 | pp125FAK PTK2 protein tyrosine kinase 2 - HPRD 11113628
PTK2 FADK | FAK | FAK1 | pp125FAK PTK2 protein tyrosine kinase 2 polycystin-1 interacts with FAK. BIND 11113628
PXN FLJ16691 paxillin - HPRD 11113628
RGS7 - regulator of G-protein signaling 7 - HPRD,BioGRID 10339594
SRC ASV | SRC1 | c-SRC | p60-Src v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) - HPRD 11113628
TLN1 ILWEQ | KIAA1027 | TLN talin 1 - HPRD 11113628


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
DEURIG T细胞PROLYMPHOCYTIC白血病 368 234 All SZGR 2.0 genes in this pathway
ODONNELL METASTASIS UP 82 58 All SZGR 2.0 genes in this pathway
HUMMERICH SKIN CANCER PROGRESSION DN 100 64 All SZGR 2.0 genes in this pathway
MARTIN INTERACT WITH HDAC 44 31 All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE AUGMENTED BY MYC 108 74 All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP 479 299 All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA ELK3 UP 209 139 All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP 811 508 All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 16P13 AMPLICON 120 49 All SZGR 2.0 genes in this pathway
DER IFN GAMMA RESPONSE DN 11 9 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 1691 1088 All SZGR 2.0 genes in this pathway
JIANG HYPOXIA NORMAL 311 205 All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP 953 554 All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP 783 442 All SZGR 2.0 genes in this pathway
HELLER SILENCED BY METHYLATION DN 105 67 All SZGR 2.0 genes in this pathway
海勒HDAC DN的目标 292 189 All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS SILENCED BY METHYLATION DN 281 179 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS DN 543 317 All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN 593 372 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN 591 366 All SZGR 2.0 genes in this pathway
MCCABE BOUND BY HOXC6 469 239 All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB UP 245 159 All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 60HR UP 293 203 All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA CHEMOTAXIS DN 457 302 All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP B 549 316 All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE 1137 655 All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS UP 682 433 All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP 489 314 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-17-5p 20/93.mr / 106/519.d 152 159 1A,m8 hsa-miR-17-5p CAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrain UAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106a AAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZ UAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZ CAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUGU
miR-200bc/429 49 56 1A,m8 hsa-miR-200b UAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200c UAAUACUGCCGGGUAAUGAUGG
hsa-miR-429 UAAUACUGUCUGGUAAAACCGU