Gene Page:PKD1
Summary?
GeneID | 5310 |
Symbol | PKD1 |
Synonyms | PBP|Pc-1|TRPP1 |
Description | polycystin 1, transient receptor potential channel interacting |
Reference | MIM:601313|HGNC:HGNC:9008|Ensembl:ENSG00000008710|HPRD:03203|织女:OTTHUMG00000155795 |
Gene type | protein-coding |
Map location | 16p13.3 |
Pascal p-value | 0.176 |
Sherlock p-value | 0.655 |
Fetal beta | -0.278 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Support | CompositeSet Darnell FMRP targets Ascano FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
探针 | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg21947488 | 16 | 2185289 | PKD1 | 5.893E-4 | 0.364 | 0.05 | DMG:Wockner_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs16829545 | chr2 | 151977407 | PKD1 | 5310 | 4.783E-9 | trans | ||
rs3845734 | chr2 | 171125572 | PKD1 | 5310 | 7.946E-5 | trans | ||
rs7584986 | chr2 | 184111432 | PKD1 | 5310 | 4.967E-4 | trans | ||
rs4240295 | chr4 | 115550111 | PKD1 | 5310 | 0.15 | trans | ||
rs2183142 | chr4 | 159232695 | PKD1 | 5310 | 0.19 | trans | ||
rs9461864 | chr6 | 33481468 | PKD1 | 5310 | 0.18 | trans | ||
rs16955618 | chr15 | 29937543 | PKD1 | 5310 | 8.68E-13 | trans | ||
rs1041786 | chr21 | 22617710 | PKD1 | 5310 | 0.03 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/PKD1_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005529 | sugar binding | IEA | - | |
GO:0005515 | protein binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007218 | neuropeptide signaling pathway | IEA | Neurotransmitter (GO term level: 8) | - |
GO:0001568 | blood vessel development | IEA | - | |
GO:0001502 | cartilage condensation | IEA | - | |
GO:0007156 | homophilic cell adhesion | TAS | 10861291 | |
GO:0007259 | JAK-STAT cascade | IEA | - | |
GO:0007161 | calcium-independent cell-matrix adhesion | TAS | 10861291 | |
GO:0007050 | cell cycle arrest | IEA | - | |
GO:0009653 | anatomical structure morphogenesis | TAS | 9326937 | |
GO:0008150 | biological_process | ND | - | |
GO:0007507 | heart development | IEA | - | |
GO:0006816 | calcium ion transport | IEA | - | |
GO:0050982 | detection of mechanical stimulus | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005575 | cellular_component | ND | - | |
GO:0005634 | nucleus | IEA | - | |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - | |
GO:0005929 | cilium | IEA | - | |
GO:0005886 | plasma membrane | IEA | - | |
GO:0005887 | integral to plasma membrane | TAS | 7663510 |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
BCAR1 | CAS | CAS1 | CASS1 | CRKAS | P130Cas | breast cancer anti-estrogen resistance 1 | - | HPRD | 11113628 |
CDH1 | Arc-1 | CD324 | CDHE | ECAD | LCAM | UVO | cadherin 1, type 1, E-cadherin (epithelial) | - | HPRD | 11274246 |
COL1A1 | OI4 | collagen, type I, alpha 1 | Reconstituted Complex | BioGRID | 11752017 |
COL2A1 | ANFH | AOM | COL11A3 | MGC131516 | SEDC | collagen, type II, alpha 1 | - | HPRD,BioGRID | 11406351 |
CTNNB1 | CTNNB | DKFZp686D02253 | FLJ25606 | FLJ37923 | catenin (cadherin-associated protein), beta 1, 88kDa | Polycystin-1 interacts with beta-catenin. | BIND | 11113628 |
CTNNB1 | CTNNB | DKFZp686D02253 | FLJ25606 | FLJ37923 | catenin (cadherin-associated protein), beta 1, 88kDa | - | HPRD | 11274246 |
FN1 | CIG | DKFZp686F10164 | DKFZp686H0342 | DKFZp686I1370 | DKFZp686O13149 | ED-B | FINC | FN | FNZ | GFND | GFND2 | LETS | MSF | fibronectin 1 | - | HPRD,BioGRID | 11752017 |
JUP | ARVD12 | CTNNG | DP3 | DPIII | PDGB | PKGB | junction plakoglobin | - | HPRD | 11274246 |
KRT18 | CYK18 | K18 | keratin 18 | - | HPRD,BioGRID | 11581269 |
PKD2 | APKD2 | MGC138466 | MGC138468 | PC2 | PKD4 | polycystic kidney disease 2 (autosomal dominant) | - | HPRD,BioGRID | 9192675 |
PKD2 | APKD2 | MGC138466 | MGC138468 | PC2 | PKD4 | polycystic kidney disease 2 (autosomal dominant) | PKD1 interacts with PKD2. | BIND | 15692563 |
PTK2 | FADK | FAK | FAK1 | pp125FAK | PTK2 protein tyrosine kinase 2 | - | HPRD | 11113628 |
PTK2 | FADK | FAK | FAK1 | pp125FAK | PTK2 protein tyrosine kinase 2 | polycystin-1 interacts with FAK. | BIND | 11113628 |
PXN | FLJ16691 | paxillin | - | HPRD | 11113628 |
RGS7 | - | regulator of G-protein signaling 7 | - | HPRD,BioGRID | 10339594 |
SRC | ASV | SRC1 | c-SRC | p60-Src | v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) | - | HPRD | 11113628 |
TLN1 | ILWEQ | KIAA1027 | TLN | talin 1 | - | HPRD | 11113628 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
DEURIG T细胞PROLYMPHOCYTIC白血病 | 368 | 234 | All SZGR 2.0 genes in this pathway |
ODONNELL METASTASIS UP | 82 | 58 | All SZGR 2.0 genes in this pathway |
HUMMERICH SKIN CANCER PROGRESSION DN | 100 | 64 | All SZGR 2.0 genes in this pathway |
MARTIN INTERACT WITH HDAC | 44 | 31 | All SZGR 2.0 genes in this pathway |
SCHLOSSER SERUM RESPONSE AUGMENTED BY MYC | 108 | 74 | All SZGR 2.0 genes in this pathway |
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP | 479 | 299 | All SZGR 2.0 genes in this pathway |
GROSS HYPOXIA VIA ELK3 UP | 209 | 139 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
NIKOLSKY BREAST CANCER 16P13 AMPLICON | 120 | 49 | All SZGR 2.0 genes in this pathway |
DER IFN GAMMA RESPONSE DN | 11 | 9 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
JIANG HYPOXIA NORMAL | 311 | 205 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP | 953 | 554 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP | 783 | 442 | All SZGR 2.0 genes in this pathway |
HELLER SILENCED BY METHYLATION DN | 105 | 67 | All SZGR 2.0 genes in this pathway |
海勒HDAC DN的目标 | 292 | 189 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS SILENCED BY METHYLATION DN | 281 | 179 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS DN | 543 | 317 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS DN | 593 | 372 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS DN | 591 | 366 | All SZGR 2.0 genes in this pathway |
MCCABE BOUND BY HOXC6 | 469 | 239 | All SZGR 2.0 genes in this pathway |
BLUM RESPONSE TO SALIRASIB UP | 245 | 159 | All SZGR 2.0 genes in this pathway |
ZHANG TLX TARGETS 60HR UP | 293 | 203 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA CHEMOTAXIS DN | 457 | 302 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP B | 549 | 316 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
FEVR CTNNB1 TARGETS UP | 682 | 433 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY STEM CELL UP | 489 | 314 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-17-5p 20/93.mr / 106/519.d | 152 | 159 | 1A,m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
miR-200bc/429 | 49 | 56 | 1A,m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.