Gene Page:CLIC5

Summary?
GeneID 53405
Symbol CLIC5
Synonyms DFNB102|DFNB103|MST130|MSTP130
Description chloride intracellular channel 5
Reference MIM:607293|HGNC:HGNC:13517|Ensembl:ENSG00000112782|HPRD:06292|Vega:OTTHUMG00000014775
Gene type protein-coding
Map location 6p12.3
Pascal p-value 0.129
Fetal beta 0.302
Support CompositeSet

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
DNM:Xu_2012 Whole Exome Sequencing analysis 新创的突变4 b基因被确定y exome sequencing of 795 samples in this study
GSMA_IIE Genome scan meta-analysis (European-ancestry samples) Psr: 0.04433

Section I. Genetics and epigenetics annotation

@DNM table

Gene Chromosome Position Ref Alt Transcript AA change Mutation type Sift CG46 Trait Study
CLIC5 chr6 46047670 C A NM_001114086 p.104G>C missense Schizophrenia DNM:Xu_2012


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0005515 protein binding 新闻学会 10793131
GO:0005244 voltage-gated ion channel activity IEA -
GO:0005247 voltage-gated chloride channel activity IEA -
GO:0031404 chloride ion binding IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0008104 protein localization IEA -
GO:0007605 sensory perception of sound IEA -
GO:0007565 female pregnancy TAS 10793131
GO:0006821 chloride transport IDA 10793131
GO:0006811 ion transport IEA -
GO:0050885 neuromuscular process controlling balance IEA -
GO:0060088 auditory receptor cell stereocilium organization IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005794 Golgi apparatus IEA -
GO:0005813 centrosome IEA -
GO:0005626 insoluble fraction IDA 10793131
GO:0005737 cytoplasm IEA -
GO:0016020 membrane IEA -
GO:0015629 actin cytoskeleton IDA 10793131
GO:0032420 stereocilium IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
THUM SYSTOLIC HEART FAILURE UP 423 283 All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER GRADES 1 2 DN 67 43 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821 933 All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS 1174 695 All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062 725 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN 546 351 All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN 830 547 All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS DN 31 23 All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN 434 302 All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 720 440 All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL DN 216 143 All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069 729 All SZGR 2.0 genes in this pathway
MIKKELSEN IPS HCP WITH H3 UNMETHYLATED 80 50 All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS UP 682 433 All SZGR 2.0 genes in this pathway
SERVITJA ISLET HNF1A TARGETS DN 109 71 All SZGR 2.0 genes in this pathway
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN 308 187 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY 1725 838 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-122 4419 4426 1A,m8 hsa-miR-122a UGGAGUGUGACAAUGGUGUUUGU
miR-182 761 767 1A hsa-miR-182 UUUGGCAAUGGUAGAACUCACA
miR-26 1247 1253 1A hsa-miR-26abrain UUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZ UUCAAGUAAUUCAGGAUAGGUU
miR-96 761 767 1A hsa-miR-96brain UUUGGCACUAGCACAUUUUUGC