Gene Page:PCDH18

Summary?
GeneID 54510
Symbol PCDH18
Synonyms PCDH68L
Description protocadherin 18
Reference MIM:608287|HGNC: HGNC: 14268|Ensembl:ENSG00000189184|HPRD:12205|Vega:OTTHUMG00000161348
Gene type protein-coding
Map location 4q31
Pascal p-value 0.098
Sherlock p-value 0.531
Fetal beta 0.828
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Expression Meta-analysis of gene expression Pvalue: 1.9
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs695809 chr22 26278127 PCDH18 54510 0.04 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005509 calcium ion binding IEA -
GO:0005515 protein binding ISS -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007420 brain development ISS Brain (GO term level: 7) -
GO:0007155 cell adhesion IEA -
GO:0007156 homophilic cell adhesion IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0016021 integral to membrane IEA -
GO:0005886 plasma membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER DN 169 118 All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION DN 329 219 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN 1375 806 All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN 537 339 All SZGR 2.0 genes in this pathway
ROVERSI GLIOMA COPY NUMBER UP 100 75 All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN 848 527 All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS DN 1024 594 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN 514 330 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN 428 306 All SZGR 2.0 genes in this pathway
SCHAEFFER SOX9 TARGETS IN PROSTATE DEVELOPMENT DN 45 33 All SZGR 2.0 genes in this pathway
SHEPARD BMYB MORPHOLINO DN 200 112 All SZGR 2.0 genes in this pathway
SHEPARD BMYB TARGETS 74 41 All SZGR 2.0 genes in this pathway
SHEPARD CRUSH AND BURN MUTANT DN 185 111 All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA CD1 VS CD2 UP 66 47 All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS LATE PROGENITOR 544 307 All SZGR 2.0 genes in this pathway
ZHANG BREAST CANCER PROGENITORS UP 425 253 All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 60HR UP 293 203 All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS DN 306 191 All SZGR 2.0 genes in this pathway
HOELZEL NF1 TARGETS DN 115 73 All SZGR 2.0 genes in this pathway
PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 DN 157 106 All SZGR 2.0 genes in this pathway
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS DN 229 135 All SZGR 2.0 genes in this pathway
PECE MAMMARY STEM CELL DN 146 88 All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP 489 314 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-101 138 144 1A hsa-miR-101 UACAGUACUGUGAUAACUGAAG
miR-144 137 144 1A,m8 hsa-miR-144 UACAGUAUAGAUGAUGUACUAG
miR-182 85 92 1A,m8 hsa-miR-182 UUUGGCAAUGGUAGAACUCACA
miR-26 969 976 1A,m8 hsa-miR-26abrain UUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZ UUCAAGUAAUUCAGGAUAGGUU
miR-380-5p 318 324 1A hsa-miR-380-5p UGGUUGACCAUAGAACAUGCGC
hsa-miR-563 AGGUUGACAUACGUUUCCC
miR-493-5p 152 158 m8 hsa-miR-493-5p UUGUACAUGGUAGGCUUUCAUU
miR-495 1102 1108 1A hsa-miR-495brain AAACAAACAUGGUGCACUUCUUU
miR-96 86 92 1A hsa-miR-96brain UUUGGCACUAGCACAUUUUUGC