Gene Page:POU6F1

Summary?
GeneID 5463
Symbol POU6F1
Synonyms BRN5|MPOU|TCFB1
Description POU class 6 homeobox 1
Reference HGNC:HGNC:9224|Ensembl:ENSG00000184271|HPRD:17883|Vega:OTTHUMG00000169622
Gene type protein-coding
Map location 12q13.13
Pascal p-value 0.198
Sherlock p-value 0.39
Fetal beta -0.466
DMG 1 (# studies)

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg23379540 12 51611600 POU6F1 2.61E-5 -0.49 0.017 DMG:Wockner_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception周),ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
FMR1 0.87 0.87
ACBD5 0.87 0.85
RAB21 0.86 0.86
HDHD2 0.84 0.83
CCDC47 0.84 0.86
DLD 0.83 0.81
FBXL3 0.82 0.83
AGGF1 0.82 0.81
SENP2 0.82 0.83
RABL3 0.82 0.80
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.21 -0.64 -0.40
IL32 -0.59 -0.48
C1orf61 -0.58 -0.53
C1orf54 -0.58 -0.42
VAMP5 -0.56 -0.40
IFI27 -0.54 -0.41
CLEC3B -0.53 -0.48
ENHO -0.53 -0.52
APOC1 -0.53 -0.40
C16orf74 -0.52 -0.46

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0003700 transcription factor activity TAS 7908264
GO:0043565 sequence-specific DNA binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007420 brain development TAS Brain (GO term level: 7) 7908264
GO:0006355 regulation of transcription, DNA-dependent IEA -
GO:0007517 muscle development TAS 7908264
GO:0007507 heart development TAS 7908264
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005634 nucleus IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
MULLIGHAN NPM1 MUTATED SIGNATURE 1 DN 126 86 All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 DN 162 116 All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA DN 394 258 All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION 12HR 43 35 All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK 1652 1023 All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK 1442 892 All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA HIF1A DN 110 78 All SZGR 2.0 genes in this pathway
MORI MATURE B LYMPHOCYTE UP 90 62 All SZGR 2.0 genes in this pathway
SHIPP DLBCL VS FOLLICULAR LYMPHOMA DN 45 28 All SZGR 2.0 genes in this pathway
GOLDRATH IMMUNE MEMORY 65 42 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER NORMAL LIKE UP 476 285 All SZGR 2.0 genes in this pathway
CONRAD STEM CELL 39 27 All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR UP 221 150 All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K27ME3 42 27 All SZGR 2.0 genes in this pathway
SENGUPTA EBNA1 ANTICORRELATED 173 85 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 1HR DN 222 147 All SZGR 2.0 genes in this pathway
LI INDUCED T TO NATURAL KILLER DN 116 83 All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D 882 506 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-335 372 378 m8 hsa-miR-335brain UCAAGAGCAAUAACGAAAAAUGU
miR-485-5p 467 474 1A,m8 hsa-miR-485-5p AGAGGCUGGCCGUGAUGAAUUC