Gene Page:RHBDL2

Summary?
GeneID 54933
Symbol RHBDL2
Synonyms RRP2
Description rhomboid, veinlet-like 2 (Drosophila)
Reference MIM:608962|HGNC:HGNC:16083|Ensembl:ENSG00000158315|HPRD:07151|
Gene type protein-coding
Map location 1p34.3
Pascal p-value 0.034

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
PSEN2 0.89 0.89
ACOT7 0.89 0.89
PPP2R5B 0.87 0.87
ATP13A2 0.87 0.88
SYNGR3 0.86 0.89
SYT3 0.86 0.88
ATP1A3 0.85 0.88
STMN3 0.84 0.86
CHPF 0.84 0.87
SEZ6L2 0.84 0.90
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.21 -0.53 -0.46
AF347015.2 -0.53 -0.43
AF347015.8 -0.53 -0.45
MT-CO2 -0.52 -0.45
AP002478.3 -0.52 -0.54
AF347015.33 -0.52 -0.44
AF347015.31 -0.51 -0.44
AC098691.2 -0.50 -0.51
NOSTRIN -0.50 -0.46
AF347015.26 -0.50 -0.41

Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0004252 serine-type endopeptidase activity IEA glutamate (GO term level: 7) -
GO:0008233 peptidase activity IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0007165 signal transduction IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0016020 membrane IEA -
GO:0016021 integral to membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
DODD NASOPHARYNGEAL CARCINOMA UP 1821 933 All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS DN 1024 594 All SZGR 2.0 genes in this pathway
LIN SILENCED BY TUMOR MICROENVIRONMENT 108 73 All SZGR 2.0 genes in this pathway
WINNEPENNINCKX MELANOMA METASTASIS UP 162 86 All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3 718 401 All SZGR 2.0 genes in this pathway
国外RB1目标融合性的 567 365 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY 1839 928 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-361 672 678 1A hsa-miR-361brain UUAUCAGAAUCUCCAGGGGUAC