Gene Page:GEMIN8
Summary?
GeneID | 54960 |
Symbol | GEMIN8 |
Synonyms | FAM51A1 |
Description | gem nuclear organelle associated protein 8 |
Reference | MIM:300962|HGNC:HGNC:26044|HPRD:06533| |
Gene type | protein-coding |
Map location | Xp22.2 |
DEG p-value | 度:Zhao_2015: p = 2.16 e-05: q = 0.0404 |
Fetal beta | 0.045 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DEG:Zhao_2015 | RNA Sequencing analysis | Transcriptome sequencing and genome-wide association analyses reveal lysosomal function and actin cytoskeleton remodeling in schizophrenia and bipolar disorder. | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/GEMIN8_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | 新闻学会 | 17023415 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000387 | spliceosomal snRNP biogenesis | IDA | 16434402 | |
GO:0006397 | mRNA processing | IEA | - | |
GO:0008380 | RNA splicing | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0032797 | SMN complex | IDA | neuron (GO term level: 6) | 16434402 |
GO:0005634 | nucleus | IDA | 16434402 | |
GO:0005681 | spliceosome | IEA | - | |
GO:0005737 | cytoplasm | IDA | 17023415 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
GAVIN FOXP3 TARGETS CLUSTER P6 | 91 | 44 | All SZGR 2.0 genes in this pathway |
IWANAGA CARCINOGENESIS BY KRAS PTEN DN | 353 | 226 | All SZGR 2.0 genes in this pathway |
LEE RECENT THYMIC EMIGRANT | 227 | 128 | All SZGR 2.0 genes in this pathway |
PURBEY TARGETS OF CTBP1 NOT SATB1 UP | 344 | 215 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-182 | 192 | 198 | m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-34b | 301 | 307 | m8 | hsa-miR-34b | UAGGCAGUGUCAUUAGCUGAUUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.