Gene Page:GEMIN8

Summary?
GeneID 54960
Symbol GEMIN8
Synonyms FAM51A1
Description gem nuclear organelle associated protein 8
Reference MIM:300962|HGNC:HGNC:26044|HPRD:06533|
Gene type protein-coding
Map location Xp22.2
DEG p-value 度:Zhao_2015: p = 2.16 e-05: q = 0.0404
Fetal beta 0.045

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DEG:Zhao_2015 RNA Sequencing analysis Transcriptome sequencing and genome-wide association analyses reveal lysosomal function and actin cytoskeleton remodeling in schizophrenia and bipolar disorder.
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0005515 protein binding 新闻学会 17023415
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0000387 spliceosomal snRNP biogenesis IDA 16434402
GO:0006397 mRNA processing IEA -
GO:0008380 RNA splicing IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0032797 SMN complex IDA neuron (GO term level: 6) 16434402
GO:0005634 nucleus IDA 16434402
GO:0005681 spliceosome IEA -
GO:0005737 cytoplasm IDA 17023415

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
SENESE HDAC3 TARGETS UP 501 327 All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER P6 91 44 All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN DN 353 226 All SZGR 2.0 genes in this pathway
LEE RECENT THYMIC EMIGRANT 227 128 All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 UP 344 215 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY 1839 928 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-182 192 198 m8 hsa-miR-182 UUUGGCAAUGGUAGAACUCACA
miR-34b 301 307 m8 hsa-miR-34b UAGGCAGUGUCAUUAGCUGAUUG