Summary?
GeneID 55246
Symbol CCDC25
Synonyms -
Description coiled-coil domain containing 25
Reference HGNC:HGNC:25591|Ensembl:ENSG00000147419|HPRD:07705|Vega:OTTHUMG00000132173
Gene type protein-coding
Map location 8p21.1
Pascal p-value 0.027
Sherlock p-value 0.908
Fetal beta -1.801
eGene Caudate basal ganglia
Cerebellar Hemisphere
Cerebellum
Frontal Cortex BA9
Nucleus accumbens basal ganglia
Putamen basal ganglia
Myers' cis & trans
Meta

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp 全基因组关联研究 GWAS
PMID:cooccur High-throughput literature-search 系统的search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I Genome scan meta-analysis Psr: 0.031
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.03086
GSMA_IIE Genome scan meta-analysis (European-ancestry samples) Psr: 0.00057
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs17503497 chr8 28091065 CCDC25 55246 0.02 cis
rs1563940 chr8 28124554 CCDC25 55246 0.14 cis
rs1563943 chr8 28145648 CCDC25 55246 0.03 cis
rs34604632 8 27581031 CCDC25 ENSG00000147419.12 3.487E-6 0 49139 gtex_brain_putamen_basal
rs7828682 8 27581508 CCDC25 ENSG00000147419.12 1.308E-8 0 48662 gtex_brain_putamen_basal
rs28692838 8 27581771 CCDC25 ENSG00000147419.12 1.308E-8 0 48399 gtex_brain_putamen_basal
rs13259826 8 27582025 CCDC25 ENSG00000147419.12 1.32E-8 0 48145 gtex_brain_putamen_basal
rs4323431 8 27584334 CCDC25 ENSG00000147419.12 2.825E-6 0 45836 gtex_brain_putamen_basal
rs7465373 8 27586427 CCDC25 ENSG00000147419.12 7.674E-8 0 43743 gtex_brain_putamen_basal
rs2004539 8 27587105 CCDC25 ENSG00000147419.12 1.004E-7 0 43065 gtex_brain_putamen_basal
rs17385236 8 27587944 CCDC25 ENSG00000147419.12 1.929E-6 0 42226 gtex_brain_putamen_basal
rs2010776 8 27590027 CCDC25 ENSG00000147419.12 2.297E-7 0 40143 gtex_brain_putamen_basal
rs9797 8 27591849 CCDC25 ENSG00000147419.12 2.365E-6 0 38321 gtex_brain_putamen_basal
rs13273652 8 27595100 CCDC25 ENSG00000147419.12 2.365E-6 0 35070 gtex_brain_putamen_basal
rs28460356 8 27595365 CCDC25 ENSG00000147419.12 2.365E-6 0 34805 gtex_brain_putamen_basal
rs34636629 8 27598042 CCDC25 ENSG00000147419.12 9.25E-7 0 32128 gtex_brain_putamen_basal
rs7825085 8 27598300 CCDC25 ENSG00000147419.12 2.365E-6 0 31870 gtex_brain_putamen_basal
rs12334989 8 27600802 CCDC25 ENSG00000147419.12 2.376E-6 0 29368 gtex_brain_putamen_basal
rs13280942 8 27602480 CCDC25 ENSG00000147419.12 1.258E-7 0 27690 gtex_brain_putamen_basal
rs17477326 8 27603200 CCDC25 ENSG00000147419.12 1.258E-7 0 26970 gtex_brain_putamen_basal
rs62498015 8 27603227 CCDC25 ENSG00000147419.12 5.097E-8 0 26943 gtex_brain_putamen_basal
rs10103758 8 27603266 CCDC25 ENSG00000147419.12 2.365E-6 0 26904 gtex_brain_putamen_basal
rs17477565 8 27608179 CCDC25 ENSG00000147419.12 1.258E-7 0 21991 gtex_brain_putamen_basal
rs55663317 8 27608269 CCDC25 ENSG00000147419.12 1.258E-7 0 21901 gtex_brain_putamen_basal
rs725361 8 27609538 CCDC25 ENSG00000147419.12 2.365E-6 0 20632 gtex_brain_putamen_basal
rs6993868 8 27613012 CCDC25 ENSG00000147419.12 5.135E-8 0 17158 gtex_brain_putamen_basal
rs13267051 8 27613316 CCDC25 ENSG00000147419.12 2.068E-7 0 16854 gtex_brain_putamen_basal
rs4732745 8 27613967 CCDC25 ENSG00000147419.12 3.674E-7 0 16203 gtex_brain_putamen_basal
rs17477830 8 27614595 CCDC25 ENSG00000147419.12 3.684E-7 0 15575 gtex_brain_putamen_basal
rs56228913 8 27616585 CCDC25 ENSG00000147419.12 4.618E-7 0 13585 gtex_brain_putamen_basal
rs17478040 8 27617875 CCDC25 ENSG00000147419.12 1.214E-6 0 12295 gtex_brain_putamen_basal
rs10110224 8 27617978 CCDC25 ENSG00000147419.12 1.584E-7 0 12192 gtex_brain_putamen_basal
rs13265718 8 27618198 CCDC25 ENSG00000147419.12 1.214E-6 0 11972 gtex_brain_putamen_basal
rs10105019 8 27621127 CCDC25 ENSG00000147419.12 8.046E-7 0 9043 gtex_brain_putamen_basal
rs13266988 8 27621774 CCDC25 ENSG00000147419.12 1.226E-6 0 8396 gtex_brain_putamen_basal
rs10102309 8 27623209 CCDC25 ENSG00000147419.12 1.598E-7 0 6961 gtex_brain_putamen_basal
rs17478353 8 27623295 CCDC25 ENSG00000147419.12 1.228E-6 0 6875 gtex_brain_putamen_basal
rs17478366 8 27623549 CCDC25 ENSG00000147419.12 1.228E-6 0 6621 gtex_brain_putamen_basal
rs17387237 8 27624163 CCDC25 ENSG00000147419.12 1.23E-6 0 6007 gtex_brain_putamen_basal
rs12155559 8 27624525 CCDC25 ENSG00000147419.12 1.23E-6 0 5645 gtex_brain_putamen_basal
rs10091671 8 27624940 CCDC25 ENSG00000147419.12 1.814E-7 0 5230 gtex_brain_putamen_basal
rs13262948 8 27625201 CCDC25 ENSG00000147419.12 1.23E-6 0 4969 gtex_brain_putamen_basal
rs10097446 8 27625974 CCDC25 ENSG00000147419.12 1.094E-7 0 4196 gtex_brain_putamen_basal
rs10093956 8 27628886 CCDC25 ENSG00000147419.12 3.038E-8 0 1284 gtex_brain_putamen_basal
rs7842666 8 27630152 CCDC25 ENSG00000147419.12 3.038E-8 0 18 gtex_brain_putamen_basal
rs34876489 8 27630231 CCDC25 ENSG00000147419.12 4.467E-7 0 -61 gtex_brain_putamen_basal
rs35767880 8 27630243 CCDC25 ENSG00000147419.12 1.23E-6 0 -73 gtex_brain_putamen_basal
rs17478513 8 27631384 CCDC25 ENSG00000147419.12 1.23E-6 0 -1214 gtex_brain_putamen_basal
rs1841311 8 27631630 CCDC25 ENSG00000147419.12 3.112E-8 0 -1460 gtex_brain_putamen_basal
rs1841310 8 27631647 CCDC25 ENSG00000147419.12 1.23E-6 0 -1477 gtex_brain_putamen_basal
rs35430328 8 27631990 CCDC25 ENSG00000147419.12 1.23E-6 0 -1820 gtex_brain_putamen_basal
rs961334 8 27632829 CCDC25 ENSG00000147419.12 4.196E-7 0 -2659 gtex_brain_putamen_basal
rs17387538 8 27635989 CCDC25 ENSG00000147419.12 1.23E-6 0 -5819 gtex_brain_putamen_basal
rs35683471 8 27636729 CCDC25 ENSG00000147419.12 1.23E-6 0 -6559 gtex_brain_putamen_basal
rs35594916 8 27638585 CCDC25 ENSG00000147419.12 5.387E-7 0 -8415 gtex_brain_putamen_basal
rs34858968 8 27640189 CCDC25 ENSG00000147419.12 1.23E-6 0 -10019 gtex_brain_putamen_basal
rs4732749 8 27640600 CCDC25 ENSG00000147419.12 1.233E-6 0 -10430 gtex_brain_putamen_basal
rs4732750 8 27644513 CCDC25 ENSG00000147419.12 4.196E-7 0 -14343 gtex_brain_putamen_basal
rs13250379 8 27651795 CCDC25 ENSG00000147419.12 1.23E-6 0 -21625 gtex_brain_putamen_basal
rs35102495 8 27652358 CCDC25 ENSG00000147419.12 1.23E-6 0 -22188 gtex_brain_putamen_basal
rs35117969 8 27657459 CCDC25 ENSG00000147419.12 1.23E-6 0 -27289 gtex_brain_putamen_basal
rs11136008 8 27658654 CCDC25 ENSG00000147419.12 1.23E-6 0 -28484 gtex_brain_putamen_basal
rs17479454 8 27668726 CCDC25 ENSG00000147419.12 1.398E-6 0 -38556 gtex_brain_putamen_basal
rs35386738 8 27669686 CCDC25 ENSG00000147419.12 1.23E-6 0 -39516 gtex_brain_putamen_basal
rs34461536 8 27670687 CCDC25 ENSG00000147419.12 1.23E-6 0 -40517 gtex_brain_putamen_basal
rs34633208 8 27675626 CCDC25 ENSG00000147419.12 1.214E-6 0 -45456 gtex_brain_putamen_basal
rs34173549 8 27678842 CCDC25 ENSG00000147419.12 1.23E-6 0 -48672 gtex_brain_putamen_basal
rs35921602 8 27687811 CCDC25 ENSG00000147419.12 8.382E-7 0 -57641 gtex_brain_putamen_basal
rs4732767 8 27693769 CCDC25 ENSG00000147419.12 7.852 e - 0 -63599 gtex_brain_putamen_basal
rs66482085 8 27694704 CCDC25 ENSG00000147419.12 7.789E-7 0 -64534 gtex_brain_putamen_basal
rs1551720 8 27698237 CCDC25 ENSG00000147419.12 1.023E-6 0 -68067 gtex_brain_putamen_basal
rs13255966 8 27699353 CCDC25 ENSG00000147419.12 1.042E-6 0 -69183 gtex_brain_putamen_basal
rs11136012 8 27699715 CCDC25 ENSG00000147419.12 1.867E-8 0 -69545 gtex_brain_putamen_basal
rs11136013 8 27700045 CCDC25 ENSG00000147419.12 4.992E-7 0 -69875 gtex_brain_putamen_basal
rs4466359 8 27705878 CCDC25 ENSG00000147419.12 1.28E-6 0 -75708 gtex_brain_putamen_basal
rs4466360 8 27705879 CCDC25 ENSG00000147419.12 1.28E-6 0 -75709 gtex_brain_putamen_basal
rs6991207 8 27706063 CCDC25 ENSG00000147419.12 2.9E-6 0 -75893 gtex_brain_putamen_basal
rs6987396 8 27706211 CCDC25 ENSG00000147419.12 2.8E-6 0 -76041 gtex_brain_putamen_basal
rs7004847 8 27706212 CCDC25 ENSG00000147419.12 2.124E-6 0 -76042 gtex_brain_putamen_basal
rs6987535 8 27706288 CCDC25 ENSG00000147419.12 2.9E-6 0 -76118 gtex_brain_putamen_basal
rs7006117 8 27706333 CCDC25 ENSG00000147419.12 2.9E-6 0 -76163 gtex_brain_putamen_basal
rs6991899 8 27706507 CCDC25 ENSG00000147419.12 2.9E-6 0 -76337 gtex_brain_putamen_basal
rs6992026 8 27706535 CCDC25 ENSG00000147419.12 2.9E-6 0 -76365 gtex_brain_putamen_basal
rs10110505 8 27707078 CCDC25 ENSG00000147419.12 2.9E-6 0 -76908 gtex_brain_putamen_basal
rs10113647 8 27707265 CCDC25 ENSG00000147419.12 2.9E-6 0 -77095 gtex_brain_putamen_basal
rs1380679 8 27707899 CCDC25 ENSG00000147419.12 2.9E-6 0 -77729 gtex_brain_putamen_basal
rs1380680 8 27707954 CCDC25 ENSG00000147419.12 2.9E-6 0 -77784 gtex_brain_putamen_basal
rs4732770 8 27708284 CCDC25 ENSG00000147419.12 2.9E-6 0 -78114 gtex_brain_putamen_basal
rs4732772 8 27708617 CCDC25 ENSG00000147419.12 2.9E-6 0 -78447 gtex_brain_putamen_basal
rs199505449 8 27708924 CCDC25 ENSG00000147419.12 1.702E-6 0 -78754 gtex_brain_putamen_basal
rs8180891 8 27708928 CCDC25 ENSG00000147419.12 8.375E-7 0 -78758 gtex_brain_putamen_basal
rs10093673 8 27709242 CCDC25 ENSG00000147419.12 2.9E-6 0 -79072 gtex_brain_putamen_basal
rs2236 8 27710100 CCDC25 ENSG00000147419.12 2.9E-6 0 -79930 gtex_brain_putamen_basal
rs7838272 8 27710261 CCDC25 ENSG00000147419.12 2.9E-6 0 -80091 gtex_brain_putamen_basal
rs4585704 8 27710502 CCDC25 ENSG00000147419.12 2.9E-6 0 -80332 gtex_brain_putamen_basal
rs6558019 8 27710794 CCDC25 ENSG00000147419.12 2.9E-6 0 -80624 gtex_brain_putamen_basal
rs13251432 8 27711048 CCDC25 ENSG00000147419.12 2.9E-6 0 -80878 gtex_brain_putamen_basal
rs13276502 8 27711232 CCDC25 ENSG00000147419.12 2.9E-6 0 -81062 gtex_brain_putamen_basal
rs4732773 8 27711338 CCDC25 ENSG00000147419.12 2.9E-6 0 -81168 gtex_brain_putamen_basal
rs4732774 8 27711377 CCDC25 ENSG00000147419.12 2.9E-6 0 -81207 gtex_brain_putamen_basal
rs4732776 8 27711673 CCDC25 ENSG00000147419.12 2.9E-6 0 -81503 gtex_brain_putamen_basal
rs4732609 8 27711793 CCDC25 ENSG00000147419.12 2.9E-6 0 -81623 gtex_brain_putamen_basal
rs7817174 8 27712226 CCDC25 ENSG00000147419.12 2.9E-6 0 -82056 gtex_brain_putamen_basal
rs7813468 8 27712236 CCDC25 ENSG00000147419.12 2.9E-6 0 -82066 gtex_brain_putamen_basal
rs7817205 8 27712292 CCDC25 ENSG00000147419.12 2.896E-6 0 -82122 gtex_brain_putamen_basal
rs12549445 8 27712672 CCDC25 ENSG00000147419.12 2.9E-6 0 -82502 gtex_brain_putamen_basal
rs11782093 8 27712744 CCDC25 ENSG00000147419.12 2.9E-6 0 -82574 gtex_brain_putamen_basal
rs11782095 8 27712758 CCDC25 ENSG00000147419.12 2.9E-6 0 -82588 gtex_brain_putamen_basal
rs11136016 8 27712875 CCDC25 ENSG00000147419.12 2.9E-6 0 -82705 gtex_brain_putamen_basal
rs7833802 8 27713037 CCDC25 ENSG00000147419.12 2.383E-6 0 -82867 gtex_brain_putamen_basal
rs7833806 8 27713042 CCDC25 ENSG00000147419.12 2.906E-6 0 -82872 gtex_brain_putamen_basal
rs7835072 8 27713167 CCDC25 ENSG00000147419.12 2.9E-6 0 -82997 gtex_brain_putamen_basal
rs7835073 8 27713170 CCDC25 ENSG00000147419.12 2.9E-6 0 -83000 gtex_brain_putamen_basal
rs7835364 8 27713351 CCDC25 ENSG00000147419.12 2.268E-6 0 -83181 gtex_brain_putamen_basal
rs7834391 8 27713426 CCDC25 ENSG00000147419.12 1.718E-6 0 -83256年 gtex_brain_putamen_basal
rs11327253 8 27713443 CCDC25 ENSG00000147419.12 9.929E-7 0 -83273 gtex_brain_putamen_basal
rs11368355 8 27713446 CCDC25 ENSG00000147419.12 1.854E-6 0 -83276 gtex_brain_putamen_basal
rs6558020 8 27713648 CCDC25 ENSG00000147419.12 2.9E-6 0 -83478 gtex_brain_putamen_basal
rs7010741 8 27714179 CCDC25 ENSG00000147419.12 2.893E-6 0 -84009 gtex_brain_putamen_basal
rs898468 8 27714736 CCDC25 ENSG00000147419.12 2.887E-6 0 -84566 gtex_brain_putamen_basal
rs898467 8 27714922 CCDC25 ENSG00000147419.12 2.875E-6 0 -84752 gtex_brain_putamen_basal
rs4363153 8 27715284 CCDC25 ENSG00000147419.12 2.875E-6 0 -85114 gtex_brain_putamen_basal
rs4473993 8 27715393 CCDC25 ENSG00000147419.12 2.875E-6 0 -85223 gtex_brain_putamen_basal
rs4342548 8 27715573 CCDC25 ENSG00000147419.12 2.875E-6 0 -85403 gtex_brain_putamen_basal
rs4316109 8 27715660 CCDC25 ENSG00000147419.12 2.875E-6 0 -85490 gtex_brain_putamen_basal
rs4276641 8 27715687 CCDC25 ENSG00000147419.12 2.875E-6 0 -85517 gtex_brain_putamen_basal
rs4422735 8 27715717 CCDC25 ENSG00000147419.12 2.876E-6 0 -85547 gtex_brain_putamen_basal
rs34325366 8 27716025 CCDC25 ENSG00000147419.12 2.742E-6 0 -85855 gtex_brain_putamen_basal
rs7823922 8 27716308 CCDC25 ENSG00000147419.12 2.875E-6 0 -86138 gtex_brain_putamen_basal
rs7845428 8 27716353 CCDC25 ENSG00000147419.12 2.875E-6 0 -86183 gtex_brain_putamen_basal
rs7824054 8 27716355 CCDC25 ENSG00000147419.12 2.875E-6 0 -86185 gtex_brain_putamen_basal
rs201399994 8 27716355 CCDC25 ENSG00000147419.12 2.895E-6 0 -86185 gtex_brain_putamen_basal
rs7824383 8 27716601 CCDC25 ENSG00000147419.12 2.875E-6 0 -86431 gtex_brain_putamen_basal
rs7815494 8 27717089 CCDC25 ENSG00000147419.12 2.874E-6 0 -86919 gtex_brain_putamen_basal
rs7828733 8 27717136 CCDC25 ENSG00000147419.12 2.875E-6 0 -86966 gtex_brain_putamen_basal
rs12546118 8 27717160 CCDC25 ENSG00000147419.12 3.055E-6 0 -86990 gtex_brain_putamen_basal
rs10097776 8 27720025 CCDC25 ENSG00000147419.12 1.343E-6 0 -89855 gtex_brain_putamen_basal
rs2100759 8 27720309 CCDC25 ENSG00000147419.12 1.377E-6 0 -90139 gtex_brain_putamen_basal
rs898460 8 27720824 CCDC25 ENSG00000147419.12 8.82E-7 0 -90654 gtex_brain_putamen_basal
rs4732779 8 27721618 CCDC25 ENSG00000147419.12 2.9E-6 0 -91448 gtex_brain_putamen_basal

Section II. Transcriptome annotation

General gene expression (GTEx)

不available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
SMC3 0.94 0.93
SET 0.94 0.90
FAM76B 0.94 0.92
TAF1A 0.93 0.89
TOP2B 0.93 0.92
CEBPZ 0.93 0.93
CEP57 0.93 0.92
CBX3 0.93 0.90
ZNF227 0.93 0.90
METTL14 0.93 0.91
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
HLA-F -0.70 -0.79
AF347015.31 -0.69 -0.85
AIFM3 -0.69 -0.77
AF347015.27 -0.68 -0.84
MT-CO2 -0.68 -0.86
PTH1R -0.68 -0.77
FBXO2 -0.68 -0.72
TSC22D4 -0.67 -0.79
AF347015.33 -0.67 -0.83
MT-CYB -0.67 -0.85

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
DAVICIONI MOLECULAR ARMS VS ERMS DN 182 111 All SZGR 2.0 genes in this pathway
DAIRKEE TERT TARGETS UP 380 213 All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS DN 314 188 All SZGR 2.0 genes in this pathway
MARSON BOUND BY E2F4 UNSTIMULATED 728 415 All SZGR 2.0 genes in this pathway
BREDEMEYER RAG SIGNALING NOT VIA ATM UP 62 29 All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS UP 395 249 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-145 1004 1011 1A,m8 hsa-miR-145 GUCCAGUUUUCCCAGGAAUCCCUU
miR-421 1019 1025 1A hsa-miR-421 GGCCUCAUUAAAUGUUUGUUG