Gene Page:PPP4C
Summary?
| GeneID | 5531 |
| Symbol | PPP4C |
| Synonyms | PP-X|PP4|PP4C|PPH3|PPP4|PPX |
| Description | protein phosphatase 4 catalytic subunit |
| Reference | MIM:602035|HGNC:HGNC:9319|Ensembl:ENSG00000149923|HPRD:03615|Vega:OTTHUMG00000132113 |
| Gene type | protein-coding |
| Map location | 16p11.2 |
| Pascal p-value | 3.932 e-6 |
| Sherlock p-value | 0.82 |
| Fetal beta | 1.228 |
| DMG | 1 (# studies) |
| eGene | Myers' cis & trans |
Gene in Data Sources
| 基因集名称 | Method of gene set | Description | Info |
|---|---|---|---|
| CNV:YES | Copy number variation studies | Manual curation | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01775 | |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0033 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Differentially methylated gene| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg11970301 | 16 | 30087888 | PPP4C | 3.2E-10 | -0.037 | 7.03E-7 | DMG:Jaffe_2016 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs4114866 | chr6 | 6257660 | PPP4C | 5531 | 0.1 | trans | ||
| rs3851513 | chr6 | 6274160 | PPP4C | 5531 | 0.05 | trans | ||
| rs2906115 | chr12 | 1248067 | PPP4C | 5531 | 0.01 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| PSD3 | 0.90 | 0.93 |
| APPL1 | 0.90 | 0.93 |
| AC010896.1 | 0.89 | 0.91 |
| RABGAP1L | 0.89 | 0.92 |
| LPGAT1 | 0.89 | 0.92 |
| DMXL2 | 0.89 | 0.91 |
| LMBRD2 | 0.88 | 0.91 |
| AKAP11 | 0.88 | 0.92 |
| RAB11FIP2 | 0.88 | 0.91 |
| HIPK3 | 0.88 | 0.91 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| C19orf36 | -0.57 | -0.64 |
| FXYD1 | -0.56 | -0.65 |
| RAB34 | -0.54 | -0.66 |
| GSDMD | -0.54 | -0.64 |
| CST3 | -0.54 | -0.64 |
| GATSL3 | -0.54 | -0.60 |
| HIGD1B | -0.54 | -0.65 |
| TLCD1 | -0.53 | -0.61 |
| DCXR | -0.53 | -0.62 |
| EIF4EBP3 | -0.53 | -0.61 |
Section III. Gene Ontology annotation
| Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004704 | NF-kappaB-inducing kinase activity | NAS | 9837938 | |
| GO:0005506 | iron ion binding | 国际能源机构 | - | |
| GO:0005515 | protein binding | 新闻学会 | 17353931 | |
| GO:0004722 | protein serine/threonine phosphatase activity | NAS | 9837938 | |
| GO:0016787 | hydrolase activity | 国际能源机构 | - | |
| GO:0030145 | manganese ion binding | 国际能源机构 | - | |
| GO:0046872 | metal ion binding | NAS | - | |
| Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
| GO:0000226 | microtubule cytoskeleton organization | NAS | - | |
| Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
| GO:0005813 | centrosome | NAS | - | |
| GO:0005634 | nucleus | NAS | - | |
| GO:0005737 | cytoplasm | 国际能源机构 | - |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| BAT3 | BAG-6 | BAG6 | D6S52E | G3 | HLA-B associated transcript 3 | Affinity Capture-MS | BioGRID | 17353931 |
| CCDC6 | D10S170 | FLJ32286 | H4 | PTC | TPC | TST1 | coiled-coil domain containing 6 | Affinity Capture-MS | BioGRID | 17353931|18715871 |
| CCT2 | 99D8.1 | CCT-beta | CCTB | MGC142074 | MGC142076 | PRO1633 | TCP-1-beta | chaperonin containing TCP1, subunit 2 (beta) | Affinity Capture-MS | BioGRID | 16085932|18715871 |
| CCT3 | CCT-gamma | CCTG | PIG48 | TCP-1-gamma | TRIC5 | chaperonin containing TCP1, subunit 3 (gamma) | Affinity Capture-MS | BioGRID | 16085932|18715871 |
| CCT4 | CCT-DELTA | Cctd | MGC126164 | MGC126165 | SRB | chaperonin containing TCP1, subunit 4 (delta) | Affinity Capture-MS | BioGRID | 16085932|18715871 |
| CCT5 | CCT-epsilon | CCTE | KIAA0098 | TCP-1-epsilon | chaperonin containing TCP1, subunit 5 (epsilon) | Affinity Capture-MS | BioGRID | 16085932|18715871 |
| CCT6A | CCT-zeta | CCT-zeta-1 | CCT6 | Cctz | HTR3 | MGC126214 | MGC126215 | MoDP-2 | TCP-1-zeta | TCP20 | TCPZ | TTCP20 | chaperonin containing TCP1, subunit 6A (zeta 1) | Affinity Capture-MS | BioGRID | 16085932|18715871 |
| CCT7 | CCT-ETA | Ccth | MGC110985 | Nip7-1 | TCP-1-eta | chaperonin containing TCP1, subunit 7 (eta) | Affinity Capture-MS | BioGRID | 16085932|18715871 |
| CCT8 | C21orf112 | Cctq | D21S246 | KIAA0002 | PRED71 | chaperonin containing TCP1, subunit 8 (theta) | Affinity Capture-MS | BioGRID | 16085932 |
| DHX38 | DDX38 | KIAA0224 | PRP16 | PRPF16 | DEAH (Asp-Glu-Ala-His) box polypeptide 38 | Affinity Capture-MS | BioGRID | 18715871 |
| GEMIN4 | DKFZp434B131 | DKFZp434D174 | HC56 | HCAP1 | HHRF-1 | p97 | gem (nuclear organelle) associated protein 4 | Affinity Capture-Western | BioGRID | 12668731 |
| HDAC3 | HD3 | RPD3 | RPD3-2 | histone deacetylase 3 | PPP4C (PP4C) interacts with HDAC3. | BIND | 15805470 |
| IGBP1 | ALPHA-4 | IBP1 | immunoglobulin (CD79A) binding protein 1 | - | HPRD,BioGRID | 9647778 |
| JUN | AP-1 | AP1 | c-Jun | jun oncogene | Reconstituted Complex | BioGRID | 9837938 |
| NFKB1 | DKFZp686C01211 | EBP-1 | KBF1 | MGC54151 | NF-kappa-B | NFKB-p105 | NFKB-p50 | p105 | nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 | - | HPRD,BioGRID | 9837938 |
| PPP2CB | PP2CB | protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform | Affinity Capture-MS | BioGRID | 17353931 |
| PPP2R1A | MGC786 | PR65A | protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform | Affinity Capture-MS | BioGRID | 17353931|18715871 |
| PPP2R5D | B56D | MGC2134 | MGC8949 | protein phosphatase 2, regulatory subunit B', delta isoform | Affinity Capture-MS | BioGRID | 18715871 |
| PPP4R1 | PP4(Rmeg) | PP4R1 | protein phosphatase 4, regulatory subunit 1 | - | HPRD,BioGRID | 10026142 |
| PPP4R2 | MGC131930 | protein phosphatase 4, regulatory subunit 2 | - | HPRD,BioGRID | 10769191 |
| PPP4R2 | MGC131930 | protein phosphatase 4, regulatory subunit 2 | - | HPRD | 10769191|12668731 |
| PPP4R4 | KIAA1622 | PP4R4 | protein phosphatase 4, regulatory subunit 4 | Affinity Capture-MS Affinity Capture-Western Reconstituted Complex |
BioGRID | 18715871 |
| REL | C-Rel | v-rel reticuloendotheliosis viral oncogene homolog (avian) | - | HPRD,BioGRID | 9837938 |
| RELA | MGC131774 | NFKB3 | p65 | v-rel reticuloendotheliosis viral oncogene homolog A (avian) | - | HPRD,BioGRID | 9837938 |
| SMEK1 | FLFL1 | KIAA2010 | MSTP033 | PP4R3A | smk-1 | smk1 | SMEK homolog 1, suppressor of mek1 (Dictyostelium) | Affinity Capture-MS Reconstituted Complex |
BioGRID | 16085932|17353931 |18715871 |
| SMEK2 | FLFL2 | FLJ31474 | KIAA1387 | PP4R3B | PSY2 | smk1 | SMEK homolog 2, suppressor of mek1 (Dictyostelium) | Affinity Capture-MS | BioGRID | 16085932|17353931 |18715871 |
| SMN1 | BCD541 | SMA | SMA1 | SMA2 | SMA3 | SMA4 | SMA@ | SMN | SMNT | T-BCD541 | survival of motor neuron 1, telomeric | Affinity Capture-Western | BioGRID | 12668731 |
| TCP1 | CCT-alpha | CCT1 | CCTa | D6S230E | TCP-1-alpha | t-complex 1 | Affinity Capture-MS | BioGRID | 16085932|18715871 |
| TIPRL | MGC3794 | TIP | TIP41 | dJ69E11.3 | TIP41, TOR signaling pathway regulator-like (S. cerevisiae) | Affinity Capture-MS Reconstituted Complex |
BioGRID | 16085932|17353931 |
| TMSB4X | FX | PTMB4 | TB4X | TMSB4 | thymosin beta 4, X-linked | - | HPRD,BioGRID | 9647778 |
| TP53 | FLJ92943 | LFS1 | TRP53 | p53 | tumor protein p53 | Reconstituted Complex | BioGRID | 9837938 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| BORCZUK MALIGNANT MESOTHELIOMA UP | 305 | 185 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
| DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
| CREIGHTON AKT1 SIGNALING VIA MTOR DN | 23 | 16 | All SZGR 2.0 genes in this pathway |
| SCHLOSSER SERUM RESPONSE UP | 134 | 93 | All SZGR 2.0 genes in this pathway |
| DAIRKEE TERT TARGETS UP | 380 | 213 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
| TARTE PLASMA CELL VS PLASMABLAST DN | 309 | 206 | All SZGR 2.0 genes in this pathway |
| MATSUDA NATURAL KILLER DIFFERENTIATION | 475 | 313 | All SZGR 2.0 genes in this pathway |
| CROMER METASTASIS DN | 81 | 58 | All SZGR 2.0 genes in this pathway |
| WELCSH BRCA1 TARGETS UP | 198 | 132 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
| RIZKI TUMOR INVASIVENESS 2D DN | 64 | 35 | All SZGR 2.0 genes in this pathway |
| GRADE COLON CANCER UP | 871 | 505 | All SZGR 2.0 genes in this pathway |
| KESHELAVA MULTIPLE DRUG RESISTANCE | 88 | 56 | All SZGR 2.0 genes in this pathway |
| HOSHIDA LIVER CANCER SUBCLASS S1 | 237 | 159 | All SZGR 2.0 genes in this pathway |
| WONG EMBRYONIC STEM CELL CORE | 335 | 193 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-128 | 45 | 52 | 1A,m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
| hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
| miR-27 | 46 | 52 | m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
| hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.