基因Page:CAMK2N1
Summary?
基因ID | 55450 |
Symbol | CAMK2N1 |
Synonyms | PRO1489 |
Description | calcium/calmodulin-dependent protein kinase II inhibitor 1 |
Reference | MIM:614986|HGNC: HGNC: 24190|Ensembl:ENSG00000162545|HPRD:13112|Vega:OTTHUMG00000002837 |
基因type | protein-coding |
Map location | 1p36.12 |
Pascal p-value | 0.091 |
Sherlock p-value | 0.696 |
Fetal beta | -0.904 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Support | INTRACELLULAR SIGNAL TRANSDUCTION SEROTONIN CompositeSet Darnell FMRP targets |
基因in Data Sources
基因set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:vanEijk_2014 | Genome-wide DNA methylation analysis | This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250). | 2 |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 5 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg14321743 | 1 | 20445662 | CAMK2N1 | 0.003 | -5.891 | DMG:vanEijk_2014 | |
cg19521927 | 1 | 20395367 | CAMK2N1 | 0.001 | -6.09 | DMG:vanEijk_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | 基因Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs235427 | chr8 | 133815575 | CAMK2N1 | 55450 | 0.19 | trans |
Section II. Transcriptome annotation
基因ral gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/CAMK2N1_DE_GTEx.png)
基因expression during devlopment (BrainCloud)
Footnote:
总共有269次ints ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
基因expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
基因 | Pearson's Correlation | Spearman's Correlation |
GRSF1 | 0.90 | 0.88 |
COG6 | 0.89 | 0.87 |
NCKAP1 | 0.88 | 0.87 |
PDHX | 0.87 | 0.87 |
PTPLAD1 | 0.87 | 0.83 |
SNX13 | 0.87 | 0.86 |
AP3M2 | 0.87 | 0.87 |
SLC25A32 | 0.87 | 0.87 |
BCL2L13 | 0.87 | 0.85 |
TMEM30A | 0.86 | 0.87 |
Top 10 negatively co-expressed genes | ||
基因 | Pearson's Correlation | Spearman's Correlation |
AF347015.21 | -0.62 | -0.42 |
AF347015.18 | -0.57 | -0.44 |
IL32 | -0.56 | -0.41 |
MT-CO2 | -0.55 | -0.42 |
AC098691.2 | -0.54 | -0.41 |
CSAG1 | -0.52 | -0.43 |
AF347015.8 | -0.52 | -0.40 |
HIGD1B | -0.52 | -0.40 |
AF347015.31 | -0.51 | -0.40 |
MT-CYB | -0.50 | -0.39 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004860 | protein kinase inhibitor activity | IEA | - | |
GO:0008427 | calcium-dependent protein kinase inhibitor activity | ISS | - | |
GO:0019901 | protein kinase binding | ISS | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0043025 | cell soma | ISS | axon, dendrite (GO term level: 4) | - |
GO:0014069 | postsynaptic density | IEA | Synap (GO term level: 10) | - |
GO:0019717 | synaptosome | IEA | Synap, Brain (GO term level: 7) | - |
GO:0030425 | dendrite | ISS | neuron, axon, dendrite (GO term level: 6) | - |
GO:0045211 | postsynaptic membrane | IEA | Synap, Neurotransmitter (GO term level: 5) | - |
GO:0045202 | synapse | IEA | neuron, Synap, Neurotransmitter, Glial (GO term level: 2) | - |
GO:0005886 | plasma membrane | IEA | - | |
GO:0030054 | cell junction | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP | 255 | 177 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL UP | 450 | 256 | All SZGR 2.0 genes in this pathway |
DN BASAKI YBX1目标 | 384 | 230 | All SZGR 2.0 genes in this pathway |
VECCHI GASTRIC CANCER EARLY UP | 430 | 232 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS 12HR DN | 209 | 122 | All SZGR 2.0 genes in this pathway |
WAMUNYOKOLI OVARIAN CANCER LMP UP | 265 | 158 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
KOYAMA SEMA3B TARGETS UP | 292 | 168 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
LIN SILENCED BY TUMOR MICROENVIRONMENT | 108 | 73 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 DN | 464 | 276 | All SZGR 2.0 genes in this pathway |
LIU SMARCA4 TARGETS | 64 | 39 | All SZGR 2.0 genes in this pathway |
BILD E2F3 ONCOGENIC SIGNATURE | 246 | 153 | All SZGR 2.0 genes in this pathway |
GAVIN FOXP3 TARGETS CLUSTER P3 | 160 | 103 | All SZGR 2.0 genes in this pathway |
SARRIO EPITHELIAL MESENCHYMAL TRANSITION UP | 180 | 114 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE UP | 857 | 456 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 24HR DN | 505 | 328 | All SZGR 2.0 genes in this pathway |
THILLAINADESAN ZNF217 TARGETS UP | 44 | 22 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS UP | 504 | 321 | All SZGR 2.0 genes in this pathway |
PEDERSEN METASTASIS BY ERBB2 ISOFORM 6 | 29 | 20 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
PEDRIOLI MIR31 TARGETS DN | 418 | 245 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-129-5p | 1074 | 1080 | m8 | hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC |
hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU | ||||
miR-138 | 1202 | 1208 | 1A | hsa-miR-138brain | AGCUGGUGUUGUGAAUC |
miR-17-5p/20/93.mr/106/519.d | 79 | 85 | m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
miR-18 | 1193 | 1199 | m8 | hsa-miR-18a | UAAGGUGCAUCUAGUGCAGAUA |
hsa-miR-18b | UAAGGUGCAUCUAGUGCAGUUA | ||||
miR-182 | 929 | 935 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-22 | 295 | 301 | 1A | hsa-miR-22brain | AAGCUGCCAGUUGAAGAACUGU |
miR-30-5p | 443 | 450 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-450 | 1074 | 1080 | 1A | hsa-miR-450 | UUUUUGCGAUGUGUUCCUAAUA |
miR-493-5p | 1227 | 1234 | 1A,m8 | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU | ||||
miR-539 | 1218 | 1224 | m8 | hsa-miR-539 | GGAGAAAUUAUCCUUGGUGUGU |
miR-9 | 6 | 12 | 1A | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
miR-93.hd/291-3p/294/295/302/372/373/520 | 78 | 84 | m8 | hsa-miR-93brain | AAAGUGCUGUUCGUGCAGGUAG |
hsa-miR-302a | UAAGUGCUUCCAUGUUUUGGUGA | ||||
hsa-miR-302b | UAAGUGCUUCCAUGUUUUAGUAG | ||||
hsa-miR-302c | UAAGUGCUUCCAUGUUUCAGUGG | ||||
hsa-miR-302d | UAAGUGCUUCCAUGUUUGAGUGU | ||||
hsa-miR-372 | AAAGUGCUGCGACAUUUGAGCGU | ||||
hsa-miR-373 | GAAGUGCUUCGAUUUUGGGGUGU | ||||
hsa-miR-520e | AAAGUGCUUCCUUUUUGAGGG | ||||
hsa-miR-520a | AAAGUGCUUCCCUUUGGACUGU | ||||
hsa-miR-520b | AAAGUGCUUCCUUUUAGAGGG | ||||
hsa-miR-520c | AAAGUGCUUCCUUUUAGAGGGUU | ||||
hsa-miR-520d | AAAGUGCUUCUCUUUGGUGGGUU | ||||
miR-96 | 928 | 935 | 1A,m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.