Gene Page:ELMOD1

Summary?
GeneID 55531
Symbol ELMOD1
Synonyms -
Description ELMO domain containing 1
Reference MIM:615456|HGNC:HGNC:25334|Ensembl:ENSG00000110675|HPRD:10934|Vega:OTTHUMG00000166361
Gene type protein-coding
Map location 11q22.3
Pascal p-value 0.417
Sherlock p-value 0.932
Fetal beta 0.049
DMG 1 (# studies)

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1
GSMA_I Genome scan meta-analysis Psr: 0.006

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg27064125 11 107461225 ELMOD1 3.23E-9 -0.016 2.16E-6 DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception周),ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
TTC17 0.95 0.95
MED23 0.94 0.95
TOPBP1 0.93 0.94
ZNF45 0.93 0.92
WDR5 0.93 0.93
ZC3H7A 0.93 0.93
HP1BP3 0.93 0.95
SMEK1 0.93 0.94
RNASEN 0.92 0.93
TSR1 0.92 0.93
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.31 -0.83 -0.89
MT-CO2 -0.82 -0.90
AF347015.27 -0.80 -0.86
MT-CYB -0.79 -0.87
AF347015.8 -0.79 -0.89
AF347015.33 -0.79 -0.85
FXYD1 -0.78 -0.85
IFI27 -0.77 -0.85
AF347015.15 -0.76 -0.86
HIGD1B -0.76 -0.85

Section III. Gene Ontology annotation

Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006909 phagocytosis IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005856 cytoskeleton IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
SENESE HDAC1 AND HDAC2 TARGETS UP 238 144 All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS 1174 695 All SZGR 2.0 genes in this pathway
PEREZ TP63 TARGETS 355 243 All SZGR 2.0 genes in this pathway
PEREZ TP53 AND TP63 TARGETS 205 145 All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038 678 All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062 725 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652 441 All SZGR 2.0 genes in this pathway
LEE TARGETS OF PTCH1 AND SUFU DN 83 69 All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS LATE PROGENITOR 544 307 All SZGR 2.0 genes in this pathway
KONDO PROSTATE CANCER WITH H3K27ME3 196 93 All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER WITH H3K27ME3 UP 295 149 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME3 AND H3K27ME3 142 103 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-141/200a 218 225 1A,m8 hsa-miR-141 UAACACUGUCUGGUAAAGAUGG
hsa-miR-200a UAACACUGUCUGGUAACGAUGU
miR-143 129 135 m8 hsa-miR-143brain UGAGAUGAAGCACUGUAGCUCA
miR-200bc/429 1477 1483 1A hsa-miR-200b UAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200c UAAUACUGCCGGGUAAUGAUGG
hsa-miR-429 UAAUACUGUCUGGUAAAACCGU
miR-34/449 34 40 m8 hsa-miR-34abrain UGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34c AGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449 UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449b AGGCAGUGUAUUGUUAGCUGGC
miR-34b 35 41 m8 hsa-miR-34b UAGGCAGUGUCAUUAGCUGAUUG
hsa-miR-34b UAGGCAGUGUCAUUAGCUGAUUG
miR-369-3p 1478 1484 m8 hsa-miR-369-3p AAUAAUACAUGGUUGAUCUUU
miR-505 1411 1417 1A hsa-miR-505 GUCAACACUUGCUGGUUUCCUC