Gene Page:MAML3
Summary?
| GeneID | 55534 |
| Symbol | MAML3 |
| Synonyms | CAGH3|ERDA3|GDN|MAM-2|MAM2|TNRC3 |
| Description | mastermind like transcriptional coactivator 3 |
| Reference | MIM:608991|HGNC:HGNC:16272|Ensembl:ENSG00000196782|HPRD:10066|Vega:OTTHUMG00000161441 |
| Gene type | protein-coding |
| Map location | 4q28 |
| Pascal p-value | 0.136 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| PRPSAP2 | 0.96 | 0.94 |
| HSF2 | 0.96 | 0.94 |
| PTBP2 | 0.95 | 0.92 |
| GART | 0.95 | 0.91 |
| GPN1 | 0.95 | 0.93 |
| DHX57 | 0.95 | 0.91 |
| GSTA4 | 0.94 | 0.94 |
| HMGN4 | 0.94 | 0.93 |
| PWP1 | 0.94 | 0.93 |
| POLR2B | 0.94 | 0.91 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.27 | -0.76 | -0.89 |
| MT-CO2 | -0.75 | -0.88 |
| HLA-F | -0.74 | -0.77 |
| AF347015.33 | -0.74 | -0.88 |
| AF347015.31 | -0.74 | -0.87 |
| AIFM3 | -0.74 | -0.77 |
| MT-CYB | -0.74 | -0.88 |
| AF347015.8 | -0.73 | -0.89 |
| AF347015.15 | -0.71 | -0.88 |
| HEPN1 | -0.71 | -0.76 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003700 | transcription factor activity | TAS | 9225980 | |
| GO:0003713 | transcription coactivator activity | IDA | 12370315 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007399 | nervous system development | TAS | neurite (GO term level: 5) | 9225980 |
| GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
| GO:0006350 | transcription | IEA | - | |
| GO:0007219 | Notch signaling pathway | IDA | 12370315 | |
| GO:0045944 | positive regulation of transcription from RNA polymerase II promoter | IDA | 12370315 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IDA | 12370315 | |
| GO:0005634 | nucleus | TAS | 9225980 | |
| GO:0016607 | nuclear speck | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG NOTCH SIGNALING PATHWAY | 47 | 35 | All SZGR 2.0 genes in this pathway |
| REACTOME PRE NOTCH TRANSCRIPTION AND TRANSLATION | 29 | 17 | All SZGR 2.0 genes in this pathway |
| REACTOME PRE NOTCH EXPRESSION AND PROCESSING | 44 | 24 | All SZGR 2.0 genes in this pathway |
| REACTOME NOTCH1 INTRACELLULAR DOMAIN REGULATES TRANSCRIPTION | 46 | 28 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY NOTCH1 | 70 | 46 | All SZGR 2.0 genes in this pathway |
| REACTOME GENERIC TRANSCRIPTION PATHWAY | 352 | 181 | All SZGR 2.0 genes in this pathway |
| REACTOME NOTCH HLH TRANSCRIPTION PATHWAY | 13 | 8 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY NOTCH | 103 | 64 | All SZGR 2.0 genes in this pathway |
| DEURIG T细胞PROLYMPHOCYTIC LEUKEMIA UP | 368 | 234 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA ANAPLASTIC DN | 537 | 339 | All SZGR 2.0 genes in this pathway |
| RODRIGUES NTN1 AND DCC TARGETS | 35 | 25 | All SZGR 2.0 genes in this pathway |
| MARCHINI TRABECTEDIN RESISTANCE UP | 21 | 16 | All SZGR 2.0 genes in this pathway |
| XU GH1 AUTOCRINE TARGETS UP | 268 | 157 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 6HR UP | 953 | 554 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 24HR UP | 783 | 442 | All SZGR 2.0 genes in this pathway |
| MOLENAAR TARGETS OF CCND1 AND CDK4 UP | 67 | 48 | All SZGR 2.0 genes in this pathway |
| CHUNG BLISTER CYTOTOXICITY DN | 44 | 29 | All SZGR 2.0 genes in this pathway |
| TAYLOR METHYLATED IN ACUTE LYMPHOBLASTIC LEUKEMIA | 77 | 52 | All SZGR 2.0 genes in this pathway |
| LEE RECENT THYMIC EMIGRANT | 227 | 128 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-101 | 2379 | 2386 | 1A,m8 | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
| miR-133 | 2111 | 2118 | 1A,m8 | hsa-miR-133a | UUGGUCCCCUUCAACCAGCUGU |
| hsa-miR-133b | UUGGUCCCCUUCAACCAGCUA | ||||
| miR-137 | 2012 | 2018 | m8 | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
| miR-144 | 2380 | 2386 | 1A | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
| miR-204/211 | 2794 | 2801 | 1A,m8 | hsa-miR-204brain | UUCCCUUUGUCAUCCUAUGCCU |
| hsa-miR-211 | UUCCCUUUGUCAUCCUUCGCCU | ||||
| miR-485-3p | 2383 | 2389 | m8 | hsa-miR-485-3p | GUCAUACACGGCUCUCCUCUCU |
| miR-486 | 1993 | 2000 | 1A,m8 | hsa-miR-486 | UCCUGUACUGAGCUGCCCCGAG |
| miR-493-5p | 2479 | 2485 | m8 | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
| miR-495 | 2288 | 2294 | m8 | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.