Gene Page:LRRC16A

Summary?
GeneID 55604
Symbol LRRC16A
Synonyms CARMIL|CARMIL1|CARMIL1a|LRRC16|dJ501N12.1|dJ501N12.5
Description leucine rich repeat containing 16A
Reference MIM:609593|HGNC:HGNC:21581|Ensembl:ENSG00000079691|HPRD:11285|Vega:OTTHUMG00000014393
Gene type protein-coding
Map location 6p22.2
Pascal p-value 3.664E-4
Fetal beta 1.08
DMG 1 (# studies)
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg20955831 6 25279788 LRRC16A 4.1E-8 -0.01 1.15E-5 DMG:Jaffe_2016

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs7551082 chr1 119540841 LRRC16A 55604 0.03 trans
rs2498500 chr1 119673092 LRRC16A 55604 0 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
KIF23 0.97 0.68
MELK 0.97 0.74
CCNA2 0.97 0.74
BUB1 0.96 0.71
PBK 0.96 0.68
CCNB2 0.96 0.71
KIF11 0.96 0.70
DEPDC1 0.96 0.60
EXO1 0.96 0.62
KIF4A 0.96 0.72
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
ASPHD1 -0.37 -0.50
HLA-F -0.37 -0.54
CA4 -0.36 -0.61
C5orf53 -0.36 -0.53
FBXO2 -0.36 -0.50
SLC9A3R2 -0.36 -0.37
TNFSF12 -0.35 -0.47
CCNI2 -0.35 -0.50
AF347015.27 -0.35 -0.57
PTH1R -0.35 -0.47

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005515 protein binding IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005737 cytoplasm IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN 663 425 All SZGR 2.0 genes in this pathway
COLDREN GEFITINIB RESISTANCE DN 230 115 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
XU HGF TARGETS INDUCED BY AKT1 48HR DN 27 17 All SZGR 2.0 genes in this pathway
LIAO METASTASIS 539 324 All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C UP 47 29 All SZGR 2.0 genes in this pathway
VANASSE BCL2 TARGETS DN 74 50 All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA CLASSICAL 162 122 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY 1839 928 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-145 374 380 m8 hsa-miR-145 GUCCAGUUUUCCCAGGAAUCCCUU
miR-153 482 488 1A hsa-miR-153 UUGCAUAGUCACAAAAGUGA
miR-19 489 495 1A hsa-miR-19a UGUGCAAAUCUAUGCAAAACUGA
hsa-miR-19b UGUGCAAAUCCAUGCAAAACUGA
miR-22 325 332 1A,m8 hsa-miR-22brain AAGCUGCCAGUUGAAGAACUGU
miR-26 308 315 1A,m8 hsa-miR-26abrain UUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZ UUCAAGUAAUUCAGGAUAGGUU
miR-381 528 534 1A hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU
miR-448 482 488 1A hsa-miR-448 UUGCAUAUGUAGGAUGUCCCAU