Gene Page:AMBRA1

Summary?
GeneID 55626
Symbol AMBRA1
Synonyms DCAF3|WDR94
Description autophagy/beclin-1 regulator 1
Reference MIM:611359|HGNC:HGNC:25990|Ensembl:ENSG00000110497|HPRD:10975|Vega:OTTHUMG00000166500
Gene type protein-coding
Map location 11p11.2
Pascal p-value 5.791E-10
Sherlock p-value 0.475
Fetal beta -0.489
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurancewith Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs17142575 chr6 6790864 AMBRA1 55626 0.17 trans
rs1568778 chr7 109250931 AMBRA1 55626 0.2 trans
rs711457 chr7 109264996 AMBRA1 55626 0.08 trans
rs16877935 chr8 31216487 AMBRA1 55626 0.14 trans
rs16877941 chr8 31219122 AMBRA1 55626 0.14 trans
rs737377 chr8 31248987 AMBRA1 55626 0.07 trans
rs16877965 chr8 31252303 AMBRA1 55626 0.08 trans
rs11235411 chr11 71688034 AMBRA1 55626 0.04 trans
rs9914334 chr17 69795668 AMBRA1 55626 0.09 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
DNAJC12 0.66 0.72
VWA5A 0.65 0.71
ADK 0.65 0.70
SCOC 0.64 0.68
MAOA 0.63 0.65
BCHE 0.63 0.60
PDHB 0.63 0.68
CCNE1 0.63 0.67
SCP2 0.63 0.65
PAM 0.63 0.70
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
SCUBE1 -0.47 -0.39
SATB2 -0.45 -0.28
NHSL1 -0.45 -0.28
SLA -0.44 -0.17
TTC28 -0.43 -0.21
WDR86 -0.42 -0.41
MPPED1 -0.42 -0.26
ADRA2A -0.42 -0.22
GJC1 -0.41 -0.25
NAV2 -0.41 -0.21

Section III. Gene Ontology annotation

Biological process GO term Evidence Neuro keywords PubMed ID
GO:0007399 nervous system development IEA neurite (GO term level: 5) -
GO:0006914 autophagy IEA -
GO:0007275 multicellular organismal development IEA -
GO:0030154 cell differentiation IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005737 cytoplasm IDA 17589504
GO:0031410 cytoplasmic vesicle IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
PARENT MTOR SIGNALING UP 567 375 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
DARWICHE SKIN TUMOR PROMOTER DN 185 115 All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK LOW DN 165 107 All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK HIGH DN 180 110 All SZGR 2.0 genes in this pathway
DARWICHE SQUAMOUS CELL CARCINOMA DN 181 107 All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS 957 597 All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED 1229 713 All SZGR 2.0 genes in this pathway
MCCABE BOUND BY HOXC6 469 239 All SZGR 2.0 genes in this pathway
ACEVEDO METHYLATED IN LIVER CANCER DN 940 425 All SZGR 2.0 genes in this pathway
CHUNG BLISTER CYTOTOXICITY UP 134 84 All SZGR 2.0 genes in this pathway
MIZUSHIMA AUTOPHAGOSOME FORMATION 19 15 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-200bc/429 739 746 1A,m8 hsa-miR-200b UAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200c UAAUACUGCCGGGUAAUGAUGG
hsa-miR-429 UAAUACUGUCUGGUAAAACCGU
miR-23 914 920 m8 hsa-miR-23abrain AUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrain AUCACAUUGCCAGGGAUUACC
miR-323 914 920 1A hsa-miR-323brain GCACAUUACACGGUCGACCUCU
miR-485-3p 907 913 1A hsa-miR-485-3p GUCAUACACGGCUCUCCUCUCU
miR-7 350 357 1A,m8 hsa-miR-7SZ UGGAAGACUAGUGAUUUUGUUG
miR-9 999 1006 1A,m8 hsa-miR-9SZ UCUUUGGUUAUCUAGCUGUAUGA