Gene Page:BTBD2

Summary?
GeneID 55643
Symbol BTBD2
Synonyms -
Description BTB domain containing 2
Reference MIM:608531|HGNC:HGNC:15504|Ensembl:ENSG00000133243|HPRD:12252|Vega:OTTHUMG00000180017
Gene type protein-coding
Map location 19p13.3
Pascal p-value 0.001
Sherlock p-value 0.753

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 0.0547

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
PCBP2 0.93 0.92
RBBP4 0.92 0.91
NONO 0.92 0.90
RBMX 0.91 0.89
ZNF143 0.91 0.90
BUB3 0.91 0.93
SNRNP40 0.91 0.90
NUP88 0.91 0.90
APEX1 0.91 0.86
SF3B3 0.91 0.91
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.31 -0.70 -0.86
AF347015.27 -0.70 -0.87
MT-CO2 -0.70 -0.87
AF347015.33 -0.69 -0.85
AF347015.8 -0.69 -0.87
MT-CYB -0.68 -0.85
AF347015.15 -0.67 -0.86
FXYD1 -0.65 -0.83
AIFM3 -0.65 -0.74
AF347015.2 -0.65 -0.85

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005515 protein binding 新闻学会 16169070|18305892
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005737 cytoplasm IEA -

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
BRD7 BP75 | CELTIX1 | NAG4 bromodomain containing 7 Two-hybrid BioGRID 16169070
C14orf1 ERG28 | NET51 chromosome 14 open reading frame 1 Two-hybrid BioGRID 16169070
C7orf64 DKFZP564O0523 | DKFZp686D1651 | HSPC304 chromosome 7 open reading frame 64 Two-hybrid BioGRID 16169070
CCDC90B MDS011 | MDS025 | MGC104239 coiled-coil domain containing 90B Two-hybrid BioGRID 16169070
COPS6 CSN6 | MOV34-34KD COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis) Two-hybrid BioGRID 16169070
CRMP1 DPYSL1 | DRP-1 | DRP1 collapsin response mediator protein 1 Two-hybrid BioGRID 16169070
EEF1A1 CCS-3 | CCS3 | EEF-1 | EEF1A | EF-Tu | EF1A | FLJ25721 | GRAF-1EF | HNGC:16303 | LENG7 | MGC102687 | MGC131894 | MGC16224 | PTI1 | eEF1A-1 eukaryotic translation elongation factor 1 alpha 1 Two-hybrid BioGRID 16169070
GAPDH G3PD | GAPD | MGC88685 glyceraldehyde-3-phosphate dehydrogenase Two-hybrid BioGRID 16169070
GBP2 - guanylate binding protein 2, interferon-inducible Two-hybrid BioGRID 16169070
GDF9 - 生长分化因子9 Two-hybrid BioGRID 16169070
IGSF21 FLJ41177 | MGC15730 immunoglobin superfamily, member 21 Two-hybrid BioGRID 16169070
PTN HARP | HBGF8 | HBNF | NEGF1 pleiotrophin Two-hybrid BioGRID 16169070
SETDB1 ESET | KG1T | KIAA0067 | KMT1E SET domain, bifurcated 1 Two-hybrid BioGRID 16169070
TLE1 ESG | ESG1 | GRG1 transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila) Two-hybrid BioGRID 16169070
TOP1 TOPI topoisomerase (DNA) I - HPRD,BioGRID 11818025
TP53 FLJ92943 | LFS1 | TRP53 | p53 tumor protein p53 Two-hybrid BioGRID 16169070
UBR1 JBS | MGC142065 | MGC142067 ubiquitin protein ligase E3 component n-recognin 1 Two-hybrid BioGRID 16169070
UNC119 HRG4 unc-119 homolog (C. elegans) Two-hybrid BioGRID 16169070


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP 1382 904 All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS UP 372 227 All SZGR 2.0 genes in this pathway
BARRIER COLON CANCER RECURRENCE DN 20 16 All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS DN 260 143 All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS DN 536 332 All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS DN 508 354 All SZGR 2.0 genes in this pathway
MEINHOLD OVARIAN CANCER LOW GRADE UP 19 15 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 UP 309 199 All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER DN 514 319 All SZGR 2.0 genes in this pathway
RICKMAN METASTASIS DN 261 155 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN 514 330 All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS DN 411 249 All SZGR 2.0 genes in this pathway
KAAB FAILED HEART ATRIUM UP 38 30 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR DN 504 323 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 18HR DN 178 121 All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA CLASSICAL 162 122 All SZGR 2.0 genes in this pathway
DURAND STROMA S UP 297 194 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-135 966 972 m8 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
hsa-miR-135b UAUGGCUUUUCAUUCCUAUGUG
miR-33 373 379 m8 hsa-miR-33 GUGCAUUGUAGUUGCAUUG
hsa-miR-33b GUGCAUUGCUGUUGCAUUGCA