Gene Page:AXL
Summary?
GeneID | 558 |
Symbol | AXL |
Synonyms | ARK|JTK11|Tyro7|UFO |
Description | AXL receptor tyrosine kinase |
Reference | MIM:109135|HGNC:HGNC:905|Ensembl:ENSG00000167601|HPRD:00171|Vega:OTTHUMG00000182727 |
Gene type | protein-coding |
Map location | 19q13.1 |
Pascal p-value | 0.04 |
Sherlock p-value | 0.228 |
Fetal beta | -0.856 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Support | CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 1 |
DNM:Fromer_2014 | Whole Exome Sequencing analysis | This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA. | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
AXL | chr19 | 41758804 | T | G | NM_001699 NM_021913 |
p.611L>V p.620L>V |
missense missense |
Schizophrenia | DNM:Fromer_2014 |
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg14892768 | 19 | 41725332 | AXL | -0.041 | 0.37 | DMG:Nishioka_2013 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs4501739 | chrX | 35960848 | AXL | 558 | 0.03 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/AXL_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004714 | transmembrane receptor protein tyrosine kinase activity | TAS | neurite (GO term level: 8) | 1656220 |
GO:0000166 | nucleotide binding | IEA | - | |
GO:0004872 | receptor activity | IEA | - | |
GO:0005524 | ATP binding | IEA | - | |
GO:0016740 | transferase activity | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0006468 | protein amino acid phosphorylation | IEA | - | |
GO:0007165 | signal transduction | TAS | 1656220 | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0016020 | membrane | IEA | - | |
GO:0005887 | integral to plasma membrane | TAS | 1656220 |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
AXL | JTK11 | UFO | AXL receptor tyrosine kinase | Axl forms a homodimer. | BIND | 12470648 |
GAS6 | AXLLG | AXSF | DKFZp666G247 | FLJ34709 | growth arrest-specific 6 | - | HPRD | 8621659 |
GAS6 | AXLLG | AXSF | DKFZp666G247 | FLJ34709 | growth arrest-specific 6 | Reconstituted Complex | BioGRID | 8939948 |
GRB2 | ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084 | growth factor receptor-bound protein 2 | Axl interacts with an unspecified isoform of Grb2. | BIND | 12470648 |
GRB2 | ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084 | growth factor receptor-bound protein 2 | - | HPRD,BioGRID | 9178760 |
LCK | YT16 | p56lck | pp58lck | lymphocyte-specific protein tyrosine kinase | - | HPRD,BioGRID | 9178760 |
NCK2 | GRB4 | NCKbeta | NCK adaptor protein 2 | Axl interacts with an unspecified isoform of Nck2. | BIND | 12470648 |
PIK3R1 | GRB1 | p85 | p85-ALPHA | phosphoinositide-3-kinase, regulatory subunit 1 (alpha) | Biochemical Activity | BioGRID | 9178760 |
PIK3R1 | GRB1 | p85 | p85-ALPHA | phosphoinositide-3-kinase, regulatory subunit 1 (alpha) | Axl interacts with an unspecified isoform of p85-alpha. | BIND | 12470648 |
PIK3R2 | P85B | p85 | p85-BETA | phosphoinositide-3-kinase, regulatory subunit 2 (beta) | Axl interacts with p85-beta. | BIND | 12470648 |
PIK3R2 | P85B | p85 | p85-BETA | phosphoinositide-3-kinase, regulatory subunit 2 (beta) | - | HPRD,BioGRID | 9178760 |
PIK3R3 | DKFZp686P05226 | FLJ41892 | p55 | p55-GAMMA | phosphoinositide-3-kinase, regulatory subunit 3 (gamma) | Axl interacts with p55-gamma. | BIND | 12470648 |
RANBP9 | RANBPM | RAN binding protein 9 | Axl interacts with RanBPM. | BIND | 12470648 |
SHC1 | FLJ26504 | SHC | SHCA | SHC (Src homology 2 domain containing) transforming protein 1 | ShcA interacts with Axl. | BIND | 8610109 |
SOCS1 | CIS1 | CISH1 | JAB | SOCS-1 | SSI-1 | SSI1 | TIP3 | 抑制cytokine signaling 1 | Axl interacts with SOCS-1. | BIND | 12470648 |
SRC | ASV | SRC1 | c-SRC | p60-Src | v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) | - | HPRD,BioGRID | 9178760 |
TENC1 | C1-TEN | C1TEN | DKFZp686D13244 | FLJ16320 | KIAA1075 | TNS2 | tensin like C1 domain containing phosphatase (tensin 2) | - | HPRD,BioGRID | 12470648 |
TENC1 | C1-TEN | C1TEN | DKFZp686D13244 | FLJ16320 | KIAA1075 | TNS2 | tensin like C1 domain containing phosphatase (tensin 2) | 妳与C1-TEN交互。 | BIND | 12470648 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID三角洲NP63路径WAY | 47 | 34 | All SZGR 2.0 genes in this pathway |
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL UP | 285 | 181 | All SZGR 2.0 genes in this pathway |
SCHUETZ BREAST CANCER DUCTAL INVASIVE UP | 351 | 230 | All SZGR 2.0 genes in this pathway |
NAM FXYD5 TARGETS DN | 18 | 11 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS BASAL DN | 455 | 304 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN | 460 | 312 | All SZGR 2.0 genes in this pathway |
BASAKI YBX1 TARGETS UP | 290 | 177 | All SZGR 2.0 genes in this pathway |
VECCHI GASTRIC CANCER ADVANCED VS EARLY UP | 175 | 120 | All SZGR 2.0 genes in this pathway |
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL DN | 275 | 168 | All SZGR 2.0 genes in this pathway |
UDAYAKUMAR MED1 TARGETS DN | 240 | 171 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
DARWICHE SKIN TUMOR PROMOTER UP | 142 | 96 | All SZGR 2.0 genes in this pathway |
DARWICHE PAPILLOMA RISK LOW UP | 162 | 104 | All SZGR 2.0 genes in this pathway |
DARWICHE PAPILLOMA RISK HIGH UP | 147 | 101 | All SZGR 2.0 genes in this pathway |
DARWICHE SQUAMOUS CELL CARCINOMA UP | 146 | 104 | All SZGR 2.0 genes in this pathway |
MAHADEVAN IMATINIB RESISTANCE UP | 23 | 15 | All SZGR 2.0 genes in this pathway |
AMUNDSON GENOTOXIC SIGNATURE | 105 | 68 | All SZGR 2.0 genes in this pathway |
TSAI RESPONSE TO IONIZING RADIATION | 149 | 101 | All SZGR 2.0 genes in this pathway |
GROSS HYPOXIA VIA ELK3 UP | 209 | 139 | All SZGR 2.0 genes in this pathway |
LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
KOYAMA SEMA3B TARGETS UP | 292 | 168 | All SZGR 2.0 genes in this pathway |
WU CELL MIGRATION | 184 | 114 | All SZGR 2.0 genes in this pathway |
MAGRANGEAS MULTIPLE MYELOMA IGLL VS IGLK DN | 24 | 18 | All SZGR 2.0 genes in this pathway |
MANALO HYPOXIA UP | 207 | 145 | All SZGR 2.0 genes in this pathway |
LEI MYB TARGETS | 318 | 215 | All SZGR 2.0 genes in this pathway |
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD DN | 162 | 102 | All SZGR 2.0 genes in this pathway |
LI WILMS TUMOR VS FETAL KIDNEY 1 UP | 182 | 119 | All SZGR 2.0 genes in this pathway |
PETROVA PROX1 TARGETS DN | 64 | 38 | All SZGR 2.0 genes in this pathway |
MUNSHI MULTIPLE MYELOMA UP | 81 | 52 | All SZGR 2.0 genes in this pathway |
REN ALVEOLAR RHABDOMYOSARCOMA DN | 408 | 274 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 14HR DN | 298 | 200 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 20HR DN | 101 | 70 | All SZGR 2.0 genes in this pathway |
ZHANG PROLIFERATING VS QUIESCENT | 51 | 41 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 18HR DN | 178 | 121 | All SZGR 2.0 genes in this pathway |
LEE AGING CEREBELLUM UP | 84 | 58 | All SZGR 2.0 genes in this pathway |
RODWELL AGING KIDNEY NO BLOOD UP | 222 | 139 | All SZGR 2.0 genes in this pathway |
RODWELL AGING KIDNEY UP | 487 | 303 | All SZGR 2.0 genes in this pathway |
ZHANG ANTIVIRAL RESPONSE TO RIBAVIRIN DN | 51 | 32 | All SZGR 2.0 genes in this pathway |
XU GH1 AUTOCRINE TARGETS UP | 268 | 157 | All SZGR 2.0 genes in this pathway |
BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
KRASNOSELSKAYA ILF3 TARGETS DN | 46 | 38 | All SZGR 2.0 genes in this pathway |
JI RESPONSE TO FSH UP | 74 | 56 | All SZGR 2.0 genes in this pathway |
ZHENG BOUND BY FOXP3 | 491 | 310 | All SZGR 2.0 genes in this pathway |
COATES MACROPHAGE M1 VS M2 UP | 81 | 52 | All SZGR 2.0 genes in this pathway |
OSADA ASCL1 TARGETS DN | 24 | 20 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE DN | 274 | 165 | All SZGR 2.0 genes in this pathway |
BOQUEST STEM CELL UP | 260 | 174 | All SZGR 2.0 genes in this pathway |
NAKAMURA METASTASIS | 47 | 28 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
QI PLASMACYTOMA UP | 259 | 185 | All SZGR 2.0 genes in this pathway |
FIRESTEIN PROLIFERATION | 175 | 125 | All SZGR 2.0 genes in this pathway |
JIANG TIP30 TARGETS UP | 46 | 28 | All SZGR 2.0 genes in this pathway |
SWEET LUNG CANCER KRAS UP | 491 | 316 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA CHEMOTAXIS DN | 457 | 302 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS DN | 668 | 419 | All SZGR 2.0 genes in this pathway |
JISON SICKLE CELL DISEASE UP | 181 | 106 | All SZGR 2.0 genes in this pathway |
KOBAYASHI EGFR SIGNALING 24HR DN | 251 | 151 | All SZGR 2.0 genes in this pathway |
MIKKELSEN ES ICP WITH H3K4ME3 | 718 | 401 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC ICP WITH H3K4ME3 | 445 | 257 | All SZGR 2.0 genes in this pathway |
SASSON RESPONSE TO GONADOTROPHINS DN | 87 | 66 | All SZGR 2.0 genes in this pathway |
SASSON RESPONSE TO FORSKOLIN DN | 88 | 68 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 30MIN DN | 150 | 99 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 2HR DN | 49 | 33 | All SZGR 2.0 genes in this pathway |
国外RB1增长目标 | 243 | 155 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
LU EZH2 TARGETS DN | 414 | 237 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 DN | 918 | 550 | All SZGR 2.0 genes in this pathway |
ISSAEVA MLL2 TARGETS | 62 | 35 | All SZGR 2.0 genes in this pathway |
PASINI SUZ12 TARGETS DN | 315 | 215 | All SZGR 2.0 genes in this pathway |
WIEDERSCHAIN TARGETS OF BMI1 AND PCGF2 | 57 | 39 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY STEM CELL UP | 489 | 314 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-24 | 1774 | 1780 | 1A | hsa-miR-24SZ | UGGCUCAGUUCAGCAGGAACAG |
miR-34/449 | 44 | 51 | 1A,m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
miR-9 | 1396 | 1402 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.