Gene Page:ARHGAP15

Summary?
GeneID 55843
Symbol ARHGAP15
Synonyms BM046
Description Rho GTPase activating protein 15
Reference MIM:610578|HGNC:HGNC:21030|Ensembl:ENSG00000075884|HPRD:06447|Vega:OTTHUMG00000131845
Gene type protein-coding
Map location 2q22.2-q22.3
Pascal p-value 0.07
Fetal beta 0.085
eGene Cortex

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
GSMA_I Genome scan meta-analysis Psr: 0.023
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.02395

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception周),ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005096 GTPase activator activity IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007165 signal transduction IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005622 intracellular IEA -
GO:0005737 cytoplasm IEA -
GO:0016020 membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
REACTOME SIGNALING BY RHO GTPASES 113 81 All SZGR 2.0 genes in this pathway
WINTER HYPOXIA DN 52 30 All SZGR 2.0 genes in this pathway
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS DN 68 49 All SZGR 2.0 genes in this pathway
SABATES COLORECTAL ADENOMA DN 291 176 All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 1 DN 378 231 All SZGR 2.0 genes in this pathway
ROVERSI GLIOMA COPY NUMBER DN 54 37 All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 2B 392 251 All SZGR 2.0 genes in this pathway
PASQUALUCCI LYMPHOMA BY GC STAGE DN 165 104 All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION DN 517 309 All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3 491 310 All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED 1229 713 All SZGR 2.0 genes in this pathway
ZHENG FOXP3 TARGETS IN THYMUS UP 196 137 All SZGR 2.0 genes in this pathway
AMUNDSON POOR SURVIVAL AFTER GAMMA RADIATION 2G 171 96 All SZGR 2.0 genes in this pathway
WALLACE PROSTATE CANCER RACE UP 299 167 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER NORMAL LIKE UP 476 285 All SZGR 2.0 genes in this pathway
LEE DIFFERENTIATING T LYMPHOCYTE 200 115 All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK 1210 725 All SZGR 2.0 genes in this pathway
POOLA INVASIVE BREAST CANCER UP 288 168 All SZGR 2.0 genes in this pathway
NAKAYAMA SOFT TISSUE TUMORS PCA1 UP 76 46 All SZGR 2.0 genes in this pathway
LI INDUCED T TO NATURAL KILLER DN 116 83 All SZGR 2.0 genes in this pathway
WANG RESPONSE TO GSK3 INHIBITOR SB216763 UP 397 206 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION TOP20 DN 18 12 All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN 321 200 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-203.1 56 62 m8 hsa-miR-203 UGAAAUGUUUAGGACCACUAG