Gene Page:ASH1L

Summary?
GeneID 55870
Symbol ASH1L
Synonyms ASH1|ASH1L1|KMT2H
Description ash1 (absent, small, or homeotic)-like (Drosophila)
Reference MIM:607999|HGNC:HGNC:19088|Ensembl:ENSG00000116539|HPRD:06416|Vega:OTTHUMG00000014011
Gene type protein-coding
Map location 1q22
Fetal beta 0.681
eGene Meta
Support CompositeSet
Darnell FMRP targets
Chromatin Remodeling Genes

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DNM:Fromer_2014 Whole Exome Sequencing analysis This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA.
GSMA_I Genome scan meta-analysis Psr: 0.0235
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.00814
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@DNM table

Gene Chromosome Position Ref Alt Transcript AA change Mutation type Sift CG46 Trait Study
ASH1L chr1 155452170 C T NM_018489 p.164R > H missense Schizophrenia DNM:Fromer_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0003677 DNA binding IEA -
去:0003702 RNA polymerase II transcription factor activity TAS 10860993
GO:0005515 protein binding IEA -
GO:0016740 transferase activity IEA -
GO:0008270 zinc ion binding IEA -
GO:0008168 methyltransferase activity IEA -
GO:0018024 histone-lysine N-methyltransferase activity IEA -
GO:0046872 metal ion binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006323 DNA packaging TAS 10860993
GO:0006355 regulation of transcription, DNA-dependent IEA -
GO:0006350 transcription IEA -
GO:0006366 transcription from RNA polymerase II promoter TAS 10860993
GO:0007267 cell-cell signaling TAS 10860993
GO:0016568 chromatin modification IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005923 tight junction TAS Brain (GO term level: 10) 10860993
GO:0005794 Golgi apparatus IDA 18029348
GO:0005634 nucleus TAS 10860993
GO:0005737 cytoplasm IDA 18029348
GO:0030054 cell junction IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0基因通路 Info
KEGG LYSINE DEGRADATION 44 29 All SZGR 2.0 genes in this pathway
KEGG TIGHT JUNCTION 134 86 All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL UP 380 215 All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP 501 327 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
MOTAMED RESPONSE TO ANDROGEN DN 6 5 All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS 1174 695 All SZGR 2.0 genes in this pathway
RASHI RESPONSE TO IONIZING RADIATION 6 84 54 All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS DN 411 249 All SZGR 2.0 genes in this pathway
PARK HSC MARKERS 44 31 All SZGR 2.0 genes in this pathway
MOREAUX MULTIPLE MYELOMA BY TACI UP 412 249 All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN 830 547 All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL 254 164 All SZGR 2.0 genes in this pathway
BILD SRC ONCOGENIC SIGNATURE 62 38 All SZGR 2.0 genes in this pathway
BILD CTNNB1 ONCOGENIC SIGNATURE 82 52 All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP 566 371 All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED 1022 619 All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR DN 185 116 All SZGR 2.0 genes in this pathway
ROME INSULIN TARGETS IN MUSCLE UP 442 263 All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE 721 492 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-1/206 1470 1476 1A hsa-miR-1 UGGAAUGUAAAGAAGUAUGUA
hsa-miR-206SZ UGGAAUGUAAGGAAGUGUGUGG
hsa-miR-613 AGGAAUGUUCCUUCUUUGCC
miR-101 1633 1639 1A hsa-miR-101 UACAGUACUGUGAUAACUGAAG
miR-103/107 2223 2229 m8 hsa-miR-103brain AGCAGCAUUGUACAGGGCUAUGA
hsa-miR-107brain AGCAGCAUUGUACAGGGCUAUCA
miR-129-5p 2020 2026 m8 hsa-miR-129brain CUUUUUGCGGUCUGGGCUUGC
hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGCU
miR-133 1388 1394 1A hsa-miR-133a UUGGUCCCCUUCAACCAGCUGU
hsa-miR-133b UUGGUCCCCUUCAACCAGCUA
miR-137 1342 1349 1A,m8 hsa-miR-137 UAUUGCUUAAGAAUACGCGUAG
miR-139 1634 1641 1A,m8 hsa-miR-139brain UCUACAGUGCACGUGUCU
miR-141/200a 1856 1862 1A hsa-miR-141 UAACACUGUCUGGUAAAGAUGG
hsa-miR-200a UAACACUGUCUGGUAACGAUGU
miR-142-3p 1932 1938 m8 hsa-miR-142-3p UGUAGUGUUUCCUACUUUAUGGA
hsa-miR-142-3p UGUAGUGUUUCCUACUUUAUGGA
miR-143 2344 2350 1A hsa-miR-143brain UGAGAUGAAGCACUGUAGCUCA
miR-144 1125 1131 m8 hsa-miR-144 UACAGUAUAGAUGAUGUACUAG
hsa-miR-144 UACAGUAUAGAUGAUGUACUAG
miR-15/16/195/424/497 2224 2231 1A,m8 hsa-miR-15abrain UAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brain UAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrain UAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZ UAGCAGCACAGAAAUAUUGGC
hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497 CAGCAGCACACUGUGGUUUGU
miR-151 2360 2366 m8 hsa-miR-151brain ACUAGACUGAAGCUCCUUGAGG
miR-17-5p/20/93.mr/106/519.d 1781 1787 m8 hsa-miR-17-5p CAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrain UAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106a AAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZ UAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZ CAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUGU
miR-203.1 1410 1416 m8 hsa-miR-203 UGAAAUGUUUAGGACCACUAG
miR-216 1829 1835 1A hsa-miR-216 UAAUCUCAGCUGGCAACUGUG
miR-219 1998 2005 1A,m8 hsa-miR-219brain UGAUUGUCCAAACGCAAUUCU
miR-329 1250 1256 1A hsa-miR-329brain AACACACCUGGUUAACCUCUUU
miR-363 2018 2024 1A hsa-miR-363 AUUGCACGGUAUCCAUCUGUAA
miR-377 2201 2207 m8 hsa-miR-377 AUCACACAAAGGCAACUUUUGU
miR-448 1180 1186 m8 hsa-miR-448 UUGCAUAUGUAGGAUGUCCCAU
miR-450 2020 2026 1A hsa-miR-450 UUUUUGCGAUGUGUUCCUAAUA
miR-503 2225 2231 1A hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG
miR-505 1962 1968 1A hsa-miR-505 GUCAACACUUGCUGGUUUCCUC
miR-543 2006 2012 1A hsa-miR-543 AAACAUUCGCGGUGCACUUCU
miR-96 1232 1238 m8 hsa-miR-96brain UUUGGCACUAGCACAUUUUUGC