Gene Page:LANCL2

Summary?
GeneID 55915
Symbol LANCL2
Synonyms GPR69B|TASP
Description LanC like 2
Reference MIM:612919|HGNC:HGNC:6509|Ensembl:ENSG00000132434|HPRD:13956|Vega:OTTHUMG00000023779
Gene type protein-coding
Map location 7q31.1-q31.33
Pascal p-value 0.276
Sherlock p-value 0.413
Fetal beta -1.324
DMG 1 (# studies)
Support INTRACELLULAR SIGNAL TRANSDUCTION
G2Cdb.humanPSD
G2Cdb.humanPSP
CompositeSet

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg25750380 7 55434429 LANCL2 5.17E-9 -0.023 2.91E-6 DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26页ostconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
TMEM132B 0.69 0.75
BCL2L13 0.68 0.68
ARNT2 0.68 0.72
SENP2 0.67 0.70
RGL1 0.67 0.69
COL5A2 0.67 0.76
SCRN1 0.66 0.65
TBC1D5 0.66 0.68
IPO8 0.65 0.63
DPY19L1 0.65 0.71
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.21 -0.51 -0.38
APOC1 -0.45 -0.31
C1orf54 -0.42 -0.37
MT-CO2 -0.41 -0.34
AF347015.18 -0.40 -0.30
AL050337.1 -0.40 -0.33
IL32 -0.40 -0.30
AF347015.8 -0.39 -0.30
FAM159B -0.38 -0.40
AC098691.2 -0.38 -0.32

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0003824 catalytic activity IEA -
GO:0005524 ATP binding NAS 11762191
GO:0005525 GTP binding NAS 11762191
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0016481 negative regulation of transcription IDA 12566319
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005829 cytosol IDA 12566319
GO:0005634 nucleus IDA 12566319
GO:0005737 cytoplasm IEA -
GO:0005886 plasma membrane IDA 12566319

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
GARY CD5 TARGETS DN 431 263 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN 770 415 All SZGR 2.0 genes in this pathway
LOCKWOOD AMPLIFIED IN LUNG CANCER 214 139 All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP 566 371 All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS REQUIRE MYC 210 123 All SZGR 2.0 genes in this pathway
FOSTER TOLERANT MACROPHAGE DN 409 268 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP 673 430 All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP 602 364 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS UP 601 369 All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA CLASSES UP 605 377 All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION UP 570 339 All SZGR 2.0 genes in this pathway
ROESSLER LIVER CANCER METASTASIS DN 53 29 All SZGR 2.0 genes in this pathway
ZWANG EGF PERSISTENTLY UP 32 24 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-494 228 234 m8 hsa-miR-494brain UGAAACAUACACGGGAAACCUCUU