Gene Page:PSEN1

Summary?
GeneID 5663
Symbol PSEN1
Synonyms AD3|FAD|PS-1|PS1|S182
Description presenilin 1
Reference MIM:104311|HGNC:HGNC:9508|Ensembl:ENSG00000080815|HPRD:00087|Vega:OTTHUMG00000141279
Gene type protein-coding
Map location 14q24.3
Pascal p-value 0.118
Sherlock p-value 0.138
Fetal beta 0.388
eGene Myers' cis & trans
Support NEUROTROPHIN SIGNALING

Gene in Data Sources
Gene set name Method of gene set Description Info
简历:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search 系统搜索PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 7
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 0.1281

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs16869851 chr4 20690056 PSEN1 5663 0.06 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
PSMA7 0.94 0.94
EIF6 0.93 0.94
C17orf49 0.92 0.93
RPL26L1 0.92 0.94
PQBP1 0.92 0.93
SEC61B 0.91 0.89
PSMD13 0.91 0.93
CCT7 0.90 0.90
NDUFB11 0.90 0.90
SNRPC 0.90 0.91
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.33 -0.72 -0.80
AF347015.26 -0.71 -0.84
AF347015.8 -0.71 -0.79
MT-CO2 -0.71 -0.76
MT-CYB -0.71 -0.79
AF347015.15 -0.71 -0.81
AF347015.27 -0.71 -0.79
AF347015.2 -0.70 -0.81
AF347015.31 -0.68 -0.75
TINAGL1 -0.66 -0.76

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0004175 endopeptidase activity IDA 8755489
GO:0008013 beta-catenin binding 新闻学会 11104755
GO:0008233 peptidase activity IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0001764 neuron migration IEA neuron (GO term level: 8) -
GO:0048167 regulation of synaptic plasticity IEA Synap (GO term level: 8) -
GO:0030900 forebrain development IEA Brain (GO term level: 8) -
GO:0048854 brain morphogenesis IEA Brain (GO term level: 8) -
GO:0001756 somitogenesis IEA -
GO:0001568 blood vessel development IEA -
GO:0001708 cell fate specification IEA -
GO:0002244 hemopoietic progenitor cell differentiation IEA -
GO:0002573 myeloid leukocyte differentiation IEA -
GO:0002286 T cell activation during immune response IEA -
GO:0001933 negative regulation of protein amino acid phosphorylation IEA -
GO:0001947 heart looping IEA -
GO:0042987 amyloid precursor protein catabolic process TAS 15274632
GO:0007176 regulation of epidermal growth factor receptor activity IEA -
GO:0006486 protein amino acid glycosylation IEA -
GO:0006509 membrane protein ectodomain proteolysis IDA 15274632
GO:0007242 intracellular signaling cascade IEA -
GO:0007220 Notch receptor processing TAS 15274632
GO:0009790 embryonic development IEA -
GO:0009791 post-embryonic development IEA -
GO:0007507 heart development IEA -
GO:0007613 memory IEA -
GO:0006916 anti-apoptosis TAS 10805794
GO:0007059 chromosome segregation TAS 10206644
GO:0043065 positive regulation of apoptosis IEA -
GO:0016337 cell-cell adhesion IMP 11953314
GO:0042325 regulation of phosphorylation IDA 9689133
GO:0016485 protein processing IDA 15274632
GO:0040011 locomotion IEA -
GO:0021904 dorsoventral neural tube patterning IEA -
GO:0050820 positive regulation of coagulation IEA -
GO:0050852 T cell receptor signaling pathway IEA -
GO:0043085 positive regulation of catalytic activity IDA 15274632
GO:0030326 embryonic limb morphogenesis IEA -
GO:0042640 anagen IEA -
GO:0045860 positive regulation of protein kinase activity IEA -
GO:0048538 thymus development IEA -
GO:0050435 beta-amyloid metabolic process IEA -
GO:0051563 smooth endoplasmic reticulum calcium ion homeostasis IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0043025 cell soma IEA axon, dendrite (GO term level: 4) -
GO:0030425 dendrite IEA neuron, axon, dendrite (GO term level: 6) -
GO:0030424 axon IEA neuron, axon, Neurotransmitter (GO term level: 6) -
GO:0000139 Golgi membrane IEA -
GO:0000776 kinetochore TAS 9298903
GO:0005794 Golgi apparatus IDA 15274632
GO:0005789 endoplasmic reticulum membrane IEA -
GO:0005622 intracellular IEA -
GO:0005624 membrane fraction TAS 8878479
GO:0005634 nucleus IEA -
GO:0005639 integral to nuclear inner membrane TAS 9298903
GO:0005640 nuclear outer membrane IDA 9246482
GO:0005739 mitochondrion IDA 12377771
GO:0005783 endoplasmic reticulum IDA 15274632
GO:0009986 cell surface IEA -
GO:0005886 plasma membrane IEA -
GO:0005887 integral to plasma membrane IDA 15274632
GO:0035253 ciliary rootlet IEA -
GO:0031410 cytoplasmic vesicle IEA -

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
APBA1 D9S411E | MINT1 | X11 | X11A | X11ALPHA amyloid beta (A4) precursor protein-binding, family A, member 1 - HPRD 12196555
APH1A 6530402N02Rik | APH-1A | CGI-78 anterior pharynx defective 1 homolog A (C. elegans) APH-1A interacts with PSEN1. BIND 12297508
APH1A 6530402N02Rik | APH-1A | CGI-78 anterior pharynx defective 1 homolog A (C. elegans) Affinity Capture-Western
Co-fractionation		 BioGRID 12297508|12471034
|14572442
APH1B APH-1B | DKFZp564D0372 | PRO1328 | PSFL | TAAV688 anterior pharynx defective 1 homolog B (C. elegans) - HPRD 12471034
APP AAA | ABETA | ABPP | AD1 | APPI | CTFgamma | CVAP | PN2 amyloid beta (A4) precursor protein - HPRD 10593990
APP AAA | ABETA | ABPP | AD1 | APPI | CTFgamma | CVAP | PN2 amyloid beta (A4) precursor protein APPswe interacts with PS-1delta-9. BIND 14756819
APP AAA | ABETA | ABPP | AD1 | APPI | CTFgamma | CVAP | PN2 amyloid beta (A4) precursor protein PS1通过APP-C100片段与应用程序交互。 BIND 10801777
APP AAA | ABETA | ABPP | AD1 | APPI | CTFgamma | CVAP | PN2 amyloid beta (A4) precursor protein PS1 interacts with APP751. BIND 9223340
APP AAA | ABETA | ABPP | AD1 | APPI | CTFgamma | CVAP | PN2 amyloid beta (A4) precursor protein PS1 interacts with APP695. BIND 9223340
APP AAA | ABETA | ABPP | AD1 | APPI | CTFgamma | CVAP | PN2 amyloid beta (A4) precursor protein PS1 interacts with APP. BIND 15448688
BCL2 Bcl-2 B-cell CLL/lymphoma 2 - HPRD,BioGRID 10521466
BCL2L1 BCL-XL/S | BCL2L | BCLX | Bcl-X | DKFZp781P2092 | bcl-xL | bcl-xS BCL2-like 1 - HPRD,BioGRID 10446169
CASP1 ICE | IL1BC | P45 caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase) PS-1 interacts with caspase 1. This interaction was modeled on a demonstrated interaction between human PS1 and mouse caspase 1. BIND 10069390
CASP3 CPP32 | CPP32B | SCA-1 caspase 3, apoptosis-related cysteine peptidase PS1 interacts with caspase 3. This interaction was modeled on a demonstrated interaction between human PS1 and mouse caspase 3. BIND 10069390
CASP4 ICE(rel)II | ICEREL-II | ICH-2 | Mih1/TX | TX caspase 4, apoptosis-related cysteine peptidase PS1 interacts with caspase 4. This interaction was modeled on a demonstrated interaction between human PS1 and mouse caspase 4. BIND 10069390
CASP7 CMH-1 | ICE-LAP3 | MCH3 caspase 7, apoptosis-related cysteine peptidase PS1 interacts with caspase 7. This interaction was modeled on a demonstrated interaction between human PS1 and mouse caspase 7. BIND 10069390
CDH1 Arc-1 | CD324 | CDHE |适应型| LCAM | UVO cadherin 1, type 1, E-cadherin (epithelial) Affinity Capture-Western BioGRID 10635315
CIB1 CIB | KIP | KIP1 | SIP2-28 calcium and integrin binding 1 (calmyrin) Two-hybrid BioGRID 10366599
CLSTN1 ALC-ALPHA | CSTN1 | FLJ32258 | KIAA0911 | PIK3CD | XB31alpha | alcalpha1 | alcalpha2 calsyntenin 1 Affinity Capture-Western BioGRID 15037614
CTNNA1 CAP102 | FLJ36832 catenin (cadherin-associated protein), alpha 1, 102kDa Affinity Capture-Western BioGRID 10635315
CTNNB1 CTNNB | DKFZp686D02253 | FLJ25606 | FLJ37923 catenin (cadherin-associated protein), beta 1, 88kDa Affinity Capture-Western BioGRID 9738936|9852041
|10341227
CTNNB1 CTNNB | DKFZp686D02253 | FLJ25606 | FLJ37923 catenin (cadherin-associated protein), beta 1, 88kDa PS1 interacts with beta-catenin. BIND 9632714
CTNND1 CAS | CTNND | KIAA0384 | P120CAS | P120CTN | p120 catenin (cadherin-associated protein), delta 1 Affinity Capture-Western
Reconstituted Complex
Two-hybrid		 BioGRID 10208590
CTNND2 GT24 | NPRAP catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein) PS1 interacts with NPRAP BIND 10037471
DOCK3 KIAA0299 | MOCA | PBP dedicator of cytokinesis 3 - HPRD 10854253
ERN1 FLJ30999 | IRE1 | IRE1P | MGC163277 | MGC163279 endoplasmic reticulum to nucleus signaling 1 - HPRD,BioGRID 10587643
FBXW7 AGO | CDC4 | DKFZp686F23254 | FBW6 | FBW7 | FBX30 | FBXO30 | FBXW6 | FLJ16457 | SEL-10 | SEL10 F-box and WD repeat domain containing 7 Affinity Capture-Western BioGRID 12354302
FLNB ABP-278 | AOI | DKFZp686A1668 | DKFZp686O033 | FH1 | FLN1L | LRS1 | SCT | TABP | TAP filamin B, beta (actin binding protein 278) Reconstituted Complex
Two-hybrid		 BioGRID 9437013
GFAP FLJ45472 glial fibrillary acidic protein - HPRD,BioGRID 12058025
HERPUD1 HERP | KIAA0025 | Mif1 | SUP homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 - HPRD,BioGRID 11799129
ICAM5 TLCN | TLN intercellular adhesion molecule 5, telencephalin - HPRD,BioGRID 11719200
KCNIP3 CSEN | DREAM | KCHIP3 | MGC18289 Kv channel interacting protein 3, calsenilin Affinity Capture-Western BioGRID 9771752|10854253
KCNIP3 CSEN | DREAM | KCHIP3 | MGC18289 Kv channel interacting protein 3, calsenilin - HPRD 12207970
KCNIP4 CALP | KCHIP4 | MGC44947 Kv channel interacting protein 4 Two-hybrid BioGRID 11847232
MAPT DDPAC | FLJ31424 | FTDP-17 | MAPTL | MGC138549 | MSTD | MTBT1 | MTBT2 | PPND | TAU microtubule-associated protein tau - HPRD,BioGRID 9689133
METTL2B FLJ11350 | FLJ12760 | METL | METTL2 | METTL2A | PSENIP1 methyltransferase like 2B Two-hybrid BioGRID 11738826
MTCH1 CGI-64 | MGC131998 | PIG60 | PSAP mitochondrial carrier homolog 1 (C. elegans) - HPRD 10551805
NCSTN APH2 | KIAA0253 nicastrin PS1 interacts with Nicastrin. BIND 10993067
NCSTN APH2 | KIAA0253 nicastrin Affinity Capture-Western BioGRID 10993067|12297508
|12471034|14572442
|15257293
NOTCH1 TAN1 | hN1 Notch homolog 1, translocation-associated (Drosophila) Affinity Capture-Western BioGRID 10077672
PKP4 FLJ31261 | FLJ42243 | p0071 plakophilin 4 - HPRD,BioGRID 10037471|10092585
PSEN1 AD3 | FAD | PS1 | S182 presenilin 1 Two-hybrid BioGRID 12535650
PSEN2 AD3L | AD4 | PS2 | STM2 presenilin 2 (Alzheimer disease 4) Affinity Capture-Western BioGRID 12471034
PSENEN MDS033 | MSTP064 | PEN-2 | PEN2 presenilin enhancer 2 homolog (C. elegans) PEN-2 interacts with PS1. BIND 15322109
PSENEN MDS033 | MSTP064 | PEN-2 | PEN2 presenilin enhancer 2 homolog (C. elegans) - HPRD,BioGRID 12198112|12639958
STX1A HPC-1 | STX1 | p35-1 syntaxin 1A (brain) PS1 interacts with syntaxin 1A. BIND 10891589
STX5 SED5 | STX5A syntaxin 5 The full-length PS1 holoprotein interacts with Syntaxin 5. BIND 15109302
TCF7L2 TCF-4 | TCF4 transcription factor 7-like 2 (T-cell specific, HMG-box) - HPRD,BioGRID 11504726
UBQLN1 DA41 | DSK2 | FLJ90054 | PLIC-1 | XDRP1 ubiquilin 1 Reconstituted Complex
Two-hybrid		 BioGRID 11076969
YME1L1 FTSH | MEG4 | PAMP | YME1L YME1-like 1 (S. cerevisiae) - HPRD,BioGRID 12214059


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG WNT SIGNALING PATHWAY 151 112 All SZGR 2.0 genes in this pathway
KEGG NOTCH SIGNALING PATHWAY 47 35 All SZGR 2.0 genes in this pathway
KEGG NEUROTROPHIN SIGNALING PATHWAY 126 103 All SZGR 2.0 genes in this pathway
KEGG ALZHEIMERS DISEASE 169 110 All SZGR 2.0 genes in this pathway
BIOCARTA HIVNEF PATHWAY 58 43 All SZGR 2.0 genes in this pathway
BIOCARTA PS1 PATHWAY 14 14 All SZGR 2.0 genes in this pathway
ST WNT BETA CATENIN PATHWAY 34 28 All SZGR 2.0 genes in this pathway
PID NOTCH PATHWAY 59 49 All SZGR 2.0 genes in this pathway
PID PS1 PATHWAY 46 39 All SZGR 2.0 genes in this pathway
PID P75 NTR PATHWAY 69 51 All SZGR 2.0 genes in this pathway
PID SYNDECAN 3 PATHWAY 17 15 All SZGR 2.0 genes in this pathway
REACTOME SIGNALLING BY NGF 217 167 All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY ERBB4 90 67 All SZGR 2.0 genes in this pathway
REACTOME NUCLEAR SIGNALING BY ERBB4 38 30 All SZGR 2.0 genes in this pathway
REACTOME ACTIVATED NOTCH1 TRANSMITS SIGNAL TO THE NUCLEUS 27 18 All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY NOTCH4 12 10 All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY NOTCH2 12 10 All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY NOTCH1 70 46 All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY NOTCH3 12 10 All SZGR 2.0 genes in this pathway
REACTOME REGULATED PROTEOLYSIS OF P75NTR 10 9 All SZGR 2.0 genes in this pathway
REACTOME NRIF SIGNALS CELL DEATH FROM THE NUCLEUS 15 10 All SZGR 2.0 genes in this pathway
REACTOME CELL DEATH SIGNALLING VIA NRAGE NRIF AND NADE 60 43 All SZGR 2.0 genes in this pathway
REACTOME P75 NTR RECEPTOR MEDIATED SIGNALLING 81 61 All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY NOTCH 103 64 All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 1 UP 380 236 All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 UP 418 263 All SZGR 2.0 genes in this pathway
ODONNELL TFRC TARGETS UP 456 228 All SZGR 2.0 genes in this pathway
MISSIAGLIA REGULATED BY METHYLATION UP 126 78 All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP 811 508 All SZGR 2.0 genes in this pathway
BENPORATH CYCLING GENES 648 385 All SZGR 2.0 genes in this pathway
SHIN B CELL LYMPHOMA CLUSTER 8 36 28 All SZGR 2.0 genes in this pathway
ZHANG RESPONSE TO IKK INHIBITOR AND TNF UP 223 140 All SZGR 2.0 genes in this pathway
ASTON MAJOR DEPRESSIVE DISORDER DN 160 110 All SZGR 2.0 genes in this pathway
ZHANG TARGETS OF EWSR1 FLI1 FUSION 88 68 All SZGR 2.0 genes in this pathway
ALCALAY AML BY NPM1 LOCALIZATION UP 140 83 All SZGR 2.0 genes in this pathway
LENAOUR DENDRITIC CELL MATURATION DN 128 90 All SZGR 2.0 genes in this pathway
AFFAR YY1 TARGETS DN 234 137 All SZGR 2.0 genes in this pathway
ABRAHAM ALPC VS MULTIPLE MYELOMA DN 19 14 All SZGR 2.0 genes in this pathway
WANG CISPLATIN RESPONSE AND XPC DN 228 146 All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 5 482 296 All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED 1022 619 All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED 1229 713 All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE UP 578 341 All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN DN 353 226 All SZGR 2.0 genes in this pathway
MCCABE BOUND BY HOXC6 469 239 All SZGR 2.0 genes in this pathway
MCCABE HOXC6 TARGETS CANCER DN 20 12 All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB UP 245 159 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS UP 491 316 All SZGR 2.0 genes in this pathway
SWEET KRAS ONCOGENIC SIGNATURE 89 56 All SZGR 2.0 genes in this pathway
HSIAO HOUSEKEEPING GENES 389 245 All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS DN 668 419 All SZGR 2.0 genes in this pathway
KYNG WERNER SYNDROM AND NORMAL AGING DN 225 124 All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE M G1 148 95 All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM A 182 108 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-9 1069 1075 1A hsa-miR-9SZ UCUUUGGUUAUCUAGCUGUAUGA