Gene Page:CA10
Summary?
GeneID | 56934 |
Symbol | CA10 |
Synonyms | CA-RPX|CARPX|HUCEP-15 |
Description | carbonic anhydrase X |
Reference | MIM:604642|HGNC:HGNC:1369|Ensembl:ENSG00000154975|HPRD:05224|Vega:OTTHUMG00000177544 |
Gene type | protein-coding |
Map location | 17q21.33 |
Pascal p-value | 0.01 |
Sherlock p-value | 0.689 |
Fetal beta | -3.327 |
Support | CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DNM:Fromer_2014 | Whole Exome Sequencing analysis | This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA. | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
CA10 | chr17 | 50149689 | G | T | NM_001082533 NM_001082534 NM_020178 |
p.42S>R p.42S>R p.42S>R |
missense missense missense |
Schizophrenia | DNM:Fromer_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/CA10_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003674 | molecular_function | ND | 11311946 | |
GO:0004089 | carbonate dehydratase activity | IEA | - | |
GO:0008270 | zinc ion binding | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0007420 | brain development | NAS | Brain (GO term level: 7) | 11311946 |
GO:0006730 | one-carbon compound metabolic process | IEA | - | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005575 | cellular_component | ND | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
ODONNELL TFRC TARGETS UP | 456 | 228 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE FIMA DN | 284 | 156 | All SZGR 2.0 genes in this pathway |
LASTOWSKA NEUROBLASTOMA COPY NUMBER UP | 181 | 108 | All SZGR 2.0 genes in this pathway |
PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
NIKOLSKY BREAST CANCER 17Q21 Q25 AMPLICON | 335 | 181 | All SZGR 2.0 genes in this pathway |
LIU SMARCA4 TARGETS | 64 | 39 | All SZGR 2.0 genes in this pathway |
IWANAGA CARCINOGENESIS BY KRAS PTEN UP | 181 | 112 | All SZGR 2.0 genes in this pathway |
SHEDDEN肺癌A5生存良好 | 70 | 32 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K27ME3 | 79 | 59 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
MIKKELSEN IPS WITH HCP H3K27ME3 | 102 | 76 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC HCP WITH H3K27ME3 | 341 | 243 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA PRONEURAL | 177 | 132 | All SZGR 2.0 genes in this pathway |
PURBEY TARGETS OF CTBP1 AND SATB1 DN | 180 | 116 | All SZGR 2.0 genes in this pathway |
LE NEURONAL DIFFERENTIATION UP | 18 | 13 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-122 | 991 | 997 | 1A | hsa-miR-122a | UGGAGUGUGACAAUGGUGUUUGU |
miR-128 | 1215 | 1221 | m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU | ||||
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-17-5p/20/93.mr/106/519.d | 1104 | 1110 | m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
miR-185 | 1143 | 1150 | 1A,m8 | hsa-miR-185brain | UGGAGAGAAAGGCAGUUC |
miR-27 | 43 | 50 | 1A,m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
miR-30-5p | 582 | 588 | m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-34/449 | 1067 | 1073 | 1A | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
miR-381 | 636 | 642 | 1A | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
miR-500 | 1150 | 1156 | m8 | hsa-miR-500 | AUGCACCUGGGCAAGGAUUCUG |
miR-542-3p | 686 | 692 | 1A | hsa-miR-542-3p | UGUGACAGAUUGAUAACUGAAA |
miR-7 | 423 | 429 | 1A | hsa-miR-7SZ | UGGAAGACUAGUGAUUUUGUUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.