Gene Page:BBX
Summary?
GeneID | 56987 |
Symbol | BBX |
Synonyms | ARTC1|HBP2|HSPC339|MDS001 |
Description | bobby sox homolog (Drosophila) |
Reference | HGNC:HGNC:14422|Ensembl:ENSG00000114439|HPRD:10688|Vega:OTTHUMG00000150360 |
Gene type | protein-coding |
Map location | 3q13.1 |
Pascal p-value | 0.003 |
Sherlock p-value | 0.537 |
DEG p-value | DEG:Zhao_2015:p=2.26e-04:q=0.0860 |
Fetal beta | -0.63 |
eGene | 元 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
CV:PheWAS | Phenome-wide association studies (PheWAS) | 157 SNPs associated with schizophrenia | 1 |
DEG:Zhao_2015 | RNA Sequencing analysis | Transcriptome sequencing and genome-wide association analyses reveal lysosomal function and actin cytoskeleton remodeling in schizophrenia and bipolar disorder. | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04359 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.04047 | |
Expression | 元-analysis of gene expression | Pvalue: 2.41 |
Section I. Genetics and epigenetics annotation
CV:PheWAS
SNP ID | Chromosome | Position | Allele | P | Function | Gene | Up/Down Distance |
---|---|---|---|---|---|---|---|
rs6437740 | 3 | 107465817 | null | 0.4825 | BBX | null |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/BBX_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception我们eks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003677 | DNA binding | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0006350 | transcription | IEA | - | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
ONKEN UVEAL MELANOMA DN | 526 | 357 | All SZGR 2.0 genes in this pathway |
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS DN | 68 | 49 | All SZGR 2.0 genes in this pathway |
TURASHVILI BREAST LOBULAR CARCINOMA VS DUCTAL NORMAL DN | 91 | 53 | All SZGR 2.0 genes in this pathway |
HOOI ST7 TARGETS DN | 123 | 78 | All SZGR 2.0 genes in this pathway |
THUM SYSTOLIC HEART FAILURE DN | 244 | 147 | All SZGR 2.0 genes in this pathway |
BASAKI YBX1 TARGETS DN | 384 | 230 | All SZGR 2.0 genes in this pathway |
WANG LMO4 TARGETS DN | 352 | 225 | All SZGR 2.0 genes in this pathway |
OSMAN BLADDER CANCER UP | 404 | 246 | All SZGR 2.0 genes in this pathway |
GINESTIER BREAST CANCER ZNF217 AMPLIFIED UP | 78 | 48 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS DN | 536 | 332 | All SZGR 2.0 genes in this pathway |
ELVIDGE HYPOXIA UP | 171 | 112 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA DN | 77 | 52 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 1 UP | 121 | 71 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
HAMAI APOPTOSIS VIA TRAIL UP | 584 | 356 | All SZGR 2.0 genes in this pathway |
PATIL LIVER CANCER | 747 | 453 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN | 483 | 336 | All SZGR 2.0 genes in this pathway |
ASTON MAJOR DEPRESSIVE DISORDER DN | 160 | 110 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP | 555 | 346 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV NHEK DN | 318 | 220 | All SZGR 2.0 genes in this pathway |
DAZARD UV RESPONSE CLUSTER G6 | 153 | 112 | All SZGR 2.0 genes in this pathway |
MONNIER POSTRADIATION TUMOR ESCAPE UP | 393 | 244 | All SZGR 2.0 genes in this pathway |
OUILLETTE CLL 13Q14 DELETION UP | 74 | 40 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER UP | 973 | 570 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP | 863 | 514 | All SZGR 2.0 genes in this pathway |
NIELSEN GIST | 98 | 66 | All SZGR 2.0 genes in this pathway |
KARLSSON TGFB1 TARGETS DN | 207 | 139 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS SENESCENT | 572 | 352 | All SZGR 2.0 genes in this pathway |
WIERENGA STAT5A TARGETS UP | 217 | 131 | All SZGR 2.0 genes in this pathway |
WIERENGA STAT5A TARGETS GROUP1 | 136 | 76 | All SZGR 2.0 genes in this pathway |
TORCHIA TARGETS OF EWSR1 FLI1 FUSION UP | 271 | 165 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-26 | 136 | 142 | 1A | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
miR-324-5p | 61 | 67 | m8 | hsa-miR-324-5p | CGCAUCCCCUAGGGCAUUGGUGU |
miR-326 | 338 | 344 | 1A | hsa-miR-326 | CCUCUGGGCCCUUCCUCCAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.