Gene Page:PTH

Summary?
GeneID 5741
Symbol PTH
Synonyms PTH1
Description parathyroid hormone
Reference MIM:168450|HGNC:HGNC:9606|Ensembl:ENSG00000152266|HPRD:01345|Vega:OTTHUMG00000165785
Gene type protein-coding
Map location 11p15.3
Pascal p-value 0.294

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search 与Schizophr Co-occuranceenia keywords: schizophrenia,schizophrenic,schizophrenias Click to show details
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 0.0359

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0005179 hormone activity TAS 10499494
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0001501 skeletal system development TAS 10913913
GO:0007186 G-protein coupled receptor protein signaling pathway TAS 7797535
GO:0007267 cell-cell signaling TAS 7721880
GO:0008628 induction of apoptosis by hormones TAS 10913913
GO:0006874 cellular calcium ion homeostasis NAS -
GO:0046058 cAMP metabolic process TAS 9927325
GO:0045453 bone resorption NAS 15080150
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005576 extracellular region NAS 14718574

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
REACTOME SIGNALING BY GPCR 920 449 All SZGR 2.0 genes in this pathway
REACTOME CLASS B 2 SECRETIN FAMILY RECEPTORS 88 58 All SZGR 2.0 genes in this pathway
REACTOME GPCR DOWNSTREAM SIGNALING 805 368 All SZGR 2.0 genes in this pathway
REACTOME G ALPHA S SIGNALLING EVENTS 121 82 All SZGR 2.0 genes in this pathway
REACTOME GPCR LIGAND BINDING 408 246 All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA DN 284 156 All SZGR 2.0 genes in this pathway
SUZUKI AMPLIFIED IN ORAL CANCER 16 12 All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE BY GAMMA AND UV RADIATION 88 65 All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE UP 226 164 All SZGR 2.0 genes in this pathway
KONDO PROSTATE CANCER WITH H3K27ME3 196 93 All SZGR 2.0 genes in this pathway
BONCI TARGETS OF MIR15A AND MIR16 1 91 75 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway
KYNG WERNER SYNDROM AND NORMAL AGING DN 225 124 All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE 721 492 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 30MIN DN 150 99 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-15/16/195/424/497 57 64 1A,m8 hsa-miR-15abrain UAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brain UAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrain UAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZ UAGCAGCACAGAAAUAUUGGC
hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497 CAGCAGCACACUGUGGUUUGU
miR-503 58 64 1A hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG