Gene Page:XPO5
Summary?
GeneID | 57510 |
Symbol | XPO5 |
Synonyms | exp5 |
Description | exportin 5 |
Reference | MIM:607845|HGNC:HGNC:17675|Ensembl:ENSG00000124571|HPRD:06385|Vega:OTTHUMG00000014742 |
Gene type | protein-coding |
Map location | 6p21.1 |
Pascal p-value | 3.634E-5 |
Sherlock p-value | 0.03 |
Fetal beta | 1.472 |
DMG | 1 (# studies) |
Support | Ascano FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:vanEijk_2014 | Genome-wide DNA methylation analysis | This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250). | 2 |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04433 |
部分即遗传学和表观遗传学注释
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg26468274 | 6 | 43544000 | XPO5;POLH | 2.721E-4 | -0.329 | 0.038 | DMG:Wockner_2014 |
cg07099407 | 6 | 43027930 | XPO5 | 0.001 | 3.607 | DMG:vanEijk_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/XPO5_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception凌晨ks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000049 | tRNA binding | IEA | - | |
GO:0005515 | protein binding | 新闻学会 | 12702765|17353931 | |
GO:0008565 | protein transporter activity | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0006611 | protein export from nucleus | IEA | - | |
GO:0031047 | gene silencing by RNA | IEA | - | |
GO:0015031 | protein transport | IEA | - | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - | |
GO:0005737 | cytoplasm | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
EEF1A1 | CCS-3 | CCS3 | EEF-1 | EEF1A | EF-Tu | EF1A | FLJ25721 | GRAF-1EF | HNGC:16303 | LENG7 | MGC102687 | MGC131894 | MGC16224 | PTI1 | eEF1A-1 | eukaryotic translation elongation factor 1 alpha 1 | - | HPRD,BioGRID | 12426393 |
FADD | GIG3 | MGC8528 | MORT1 | Fas (TNFRSF6)-associated via death domain | - | HPRD | 12702765 |
GSTK1 | GST13 | glutathione S-transferase kappa 1 | Affinity Capture-MS | BioGRID | 17353931 |
ILF3 | CBTF | DRBF | DRBP76 | MMP4 | MPHOSPH4 | MPP4 | NF-AT-90 | NF110 | NF90 | NFAR | NFAR-1 | NFAR2 | TCP110 | TCP80 | interleukin enhancer binding factor 3, 90kDa | - | HPRD,BioGRID | 11777942 |
MAGEA6 | MAGE-3b | MAGE3B | MAGE6 | MGC52297 | melanoma antigen family A, 6 | Affinity Capture-MS | BioGRID | 17353931 |
NEK6 | SID6-1512 | NIMA (never in mitosis gene a)-related kinase 6 | Affinity Capture-MS | BioGRID | 17353931 |
NUP153 | HNUP153 | N153 | nucleoporin 153kDa | - | HPRD,BioGRID | 11777942 |
NUP214 | CAIN | CAN | D9S46E | MGC104525 | N214 | nucleoporin 214kDa | - | HPRD,BioGRID | 11777942 |
PHLDA3 | TIH1 | pleckstrin homology-like domain, family A, member 3 | Affinity Capture-MS | BioGRID | 17353931 |
PTP4A3 | PRL-3 | PRL-R | PRL3 | protein tyrosine phosphatase type IVA, member 3 | Affinity Capture-MS | BioGRID | 17353931 |
RAN | ARA24 | Gsp1 | TC4 | RAN, member RAS oncogene family | - | HPRD,BioGRID | 11777942 |
SERINC3 | AIGP1 | DIFF33 | SBBI99 | TDE | TDE1 | TMS-1 | serine incorporator 3 | Affinity Capture-MS | BioGRID | 17353931 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
REACTOME MICRORNA MIRNA BIOGENESIS | 23 | 9 | All SZGR 2.0 genes in this pathway |
REACTOME REGULATORY RNA PATHWAYS | 26 | 12 | All SZGR 2.0 genes in this pathway |
WINTER HYPOXIA UP | 92 | 57 | All SZGR 2.0 genes in this pathway |
VECCHI GASTRIC CANCER EARLY UP | 430 | 232 | All SZGR 2.0 genes in this pathway |
GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN | 335 | 193 | All SZGR 2.0 genes in this pathway |
GINESTIER BREAST CANCER 20Q13 AMPLIFICATION DN | 180 | 101 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
PATIL LIVER CANCER | 747 | 453 | All SZGR 2.0 genes in this pathway |
HATADA METHYLATED IN LUNG CANCER UP | 390 | 236 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS LATE PROGENITOR | 544 | 307 | All SZGR 2.0 genes in this pathway |
BILD MYC ONCOGENIC SIGNATURE | 206 | 117 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
MONNIER POSTRADIATION TUMOR ESCAPE UP | 393 | 244 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS DN | 543 | 317 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS DN | 593 | 372 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS DN | 591 | 366 | All SZGR 2.0 genes in this pathway |
TOYOTA TARGETS OF MIR34B AND MIR34C | 463 | 262 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124/506 | 888 | 894 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-29 | 1290 | 1296 | m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
miR-34/449 | 81 | 88 | 1A,m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.