Gene Page:BEGAIN

Summary?
GeneID 57596
Symbol BEGAIN
Synonyms -
Description brain enriched guanylate kinase associated
Reference HGNC:HGNC:24163|Ensembl:ENSG00000183092|HPRD:06459|Vega:OTTHUMG00000171589
Gene type protein-coding
Map location 14q32.2
Pascal p-value 0.041
Sherlock p-value 0.287
Support INTRACELLULAR SIGNAL TRANSDUCTION

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 0.0119

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0005515 protein binding 新闻学会 16189514
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005794 Golgi apparatus IDA 18029348
GO:0005634 nucleus IDA 18029348
GO:0005737 cytoplasm IEA -
GO:0016020 membrane IEA -

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
ABLIM1 ABLIM | DKFZp781D0148 | FLJ14564 | KIAA0059 |LIMAB1 | LIMATIN | MGC1224 actin binding LIM protein 1 Two-hybrid BioGRID 16189514
BAHD1 KIAA0945 bromo adjacent homology domain containing 1 Two-hybrid BioGRID 16189514
BEGAIN KIAA1446 brain-enriched guanylate kinase-associated homolog (rat) - HPRD,BioGRID 12097487
C16orf48 DAKV6410 | DKFZp434A1319 chromosome 16 open reading frame 48 Two-hybrid BioGRID 16189514
C17orf28 DMC1 | FLJ43526 chromosome 17 open reading frame 28 Two-hybrid BioGRID 16189514
CATSPER1 CATSPER | MGC33335 | MGC33368 cation channel, sperm associated 1 Two-hybrid BioGRID 16189514
DEF6 IBP | SLAT differentially expressed in FDCP 6 homolog (mouse) Two-hybrid BioGRID 16189514
DLG1 DKFZp761P0818 | DKFZp781B0426 | DLGH1 | SAP97 | dJ1061C18.1.1 | hdlg discs, large homolog 1 (Drosophila) - HPRD 9756850
DLG4 FLJ97752 | FLJ98574 | PSD95 | SAP90 discs, large homolog 4 (Drosophila) - HPRD 9756850
DTNB MGC17163 | MGC57126 dystrobrevin, beta Two-hybrid BioGRID 16189514
FAM107A DRR1 | FLJ30158 | FLJ45473 | TU3A family with sequence similarity 107, member A Two-hybrid BioGRID 16189514
HGS HRS | ZFYVE8 hepatocyte growth factor-regulated tyrosine kinase substrate Two-hybrid BioGRID 16189514
KIAA0408 FLJ43995 | RP3-403A15.2 KIAA0408 Two-hybrid BioGRID 16189514
RBL1 CP107 | MGC40006 | PRB1 | p107 retinoblastoma-like 1 (p107) Affinity Capture-Western
Two-hybrid		 BioGRID 16189514
RIBC2 C22orf11 RIB43A domain with coiled-coils 2 Two-hybrid BioGRID 16189514
TRIM27 RFP | RNF76 tripartite motif-containing 27 Two-hybrid BioGRID 16189514
USP2 UBP41 | USP9 ubiquitin specific peptidase 2 Two-hybrid BioGRID 16189514
ZFP64 MGC940 | ZNF338 zinc finger protein 64 homolog (mouse) Two-hybrid BioGRID 16189514
ZNF250 FLJ57354 | MGC111123 | MGC9718 | ZFP647 | ZNF647 zinc finger protein 250 Two-hybrid BioGRID 16189514
ZNF417 MGC34079 zinc finger protein 417 Two-hybrid BioGRID 16189514


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
MULLIGHAN MLL SIGNATURE 1 UP 380 236 All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 UP 418 263 All SZGR 2.0 genes in this pathway
LEE NEURAL CREST STEM CELL DN 118 79 All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL DN 186 107 All SZGR 2.0 genes in this pathway
HATADA METHYLATED IN LUNG CANCER UP 390 236 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS VIA AKT1 UP 281 183 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
let-7/98 695 702 1A,m8 hsa-let-7abrain UGAGGUAGUAGGUUGUAUAGUU
hsa-let-7bbrain UGAGGUAGUAGGUUGUGUGGUU
hsa-let-7cbrain UGAGGUAGUAGGUUGUAUGGUU
hsa-let-7dbrain AGAGGUAGUAGGUUGCAUAGU
hsa-let-7ebrain UGAGGUAGGAGGUUGUAUAGU
hsa-let-7fbrain UGAGGUAGUAGAUUGUAUAGUU
hsa-miR-98brain UGAGGUAGUAAGUUGUAUUGUU
hsa-let-7gSZ UGAGGUAGUAGUUUGUACAGU
hsa-let-7ibrain UGAGGUAGUAGUUUGUGCUGU