Gene Page:DPP10

Summary?
GeneID 57628
Symbol DPP10
Synonyms DPL2|DPPY|DPRP-3|DPRP3
Description dipeptidyl peptidase like 10
Reference MIM:608209|HGNC:HGNC:20823|Ensembl:ENSG00000175497|HPRD:07083|Vega:OTTHUMG00000153294
Gene type protein-coding
Map location 2q14.1
Pascal p-value 0.007
Sherlock p-value 0.745
eGene Caudate basal ganglia
元

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search 系统搜索PubMed的基因co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I Genome scan meta-analysis Psr: 0.0004
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.00755
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0008236 serine-type peptidase activity IEA glutamate (GO term level: 6) -
GO:0008239 dipeptidyl-peptidase activity IDA 12662155
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006508 proteolysis IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005624 membrane fraction IDA 12662155
GO:0016020 membrane IEA -
GO:0016021 integral to membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
SABATES COLORECTAL ADENOMA DN 291 176 All SZGR 2.0 genes in this pathway
THEODOROU MAMMARY TUMORIGENESIS 31 24 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN 428 306 All SZGR 2.0 genes in this pathway
NIELSEN GIST AND SYNOVIAL SARCOMA UP 20 15 All SZGR 2.0 genes in this pathway
MCCABE BOUND BY HOXC6 469 239 All SZGR 2.0 genes in this pathway
YAUCH HEDGEHOG SIGNALING PARACRINE UP 149 85 All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069 729 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 349 234 All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3 435 318 All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K27ME3 341 243 All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3 590 403 All SZGR 2.0 genes in this pathway
NIELSEN GIST VS SYNOVIAL SARCOMA DN 20 17 All SZGR 2.0 genes in this pathway
NIELSEN GIST 98 66 All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM B 517 302 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY 1725 838 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-18 576 582 m8 hsa-miR-18a UAAGGUGCAUCUAGUGCAGAUA
hsa-miR-18b UAAGGUGCAUCUAGUGCAGUUA
miR-181 1968 1974 m8 hsa-miR-181abrain AACAUUCAACGCUGUCGGUGAGU
hsa-miR-181bSZ AACAUUCAUUGCUGUCGGUGGG
hsa-miR-181cbrain AACAUUCAACCUGUCGGUGAGU
hsa-miR-181dbrain AACAUUCAUUGUUGUCGGUGGGUU
miR-22 94 100 m8 hsa-miR-22brain AAGCUGCCAGUUGAAGAACUGU
miR-24 779 785 1A hsa-miR-24SZ UGGCUCAGUUCAGCAGGAACAG
miR-25/32/92/363/367 441 447 m8 hsa-miR-25brain CAUUGCACUUGUCUCGGUCUGA
hsa-miR-32 UAUUGCACAUUACUAAGUUGC
hsa-miR-92 UAUUGCACUUGUCCCGGCCUG
hsa-miR-367 AAUUGCACUUUAGCAAUGGUGA
hsa-miR-92bSZ UAUUGCACUCGUCCCGGCCUC
miR-33 980 987 1A,m8 hsa-miR-33 GUGCAUUGUAGUUGCAUUG
hsa-miR-33b GUGCAUUGCUGUUGCAUUGCA
miR-330 1681 1687 m8 hsa-miR-330brain GCAAAGCACACGGCCUGCAGAGA
miR-361 958 965 1A,m8 hsa-miR-361brain UUAUCAGAAUCUCCAGGGGUAC
miR-495 972 978 1A hsa-miR-495brain AAACAAACAUGGUGCACUUCUUU
miR-496 922 929 1A,m8 hsa-miR-496 AUUACAUGGCCAAUCUC
miR-542-3p 917 923 1A hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA
miR-544 187 193 m8 hsa-miR-544 AUUCUGCAUUUUUAGCAAGU