Gene Page:ALS2

Summary?
GeneID 57679
象征 ALS2
Synonyms ALS2CR6|ALSJ|IAHSP|PLSJ
Description ALS2, alsin Rho guanine nucleotide exchange factor
Reference MIM:606352|HGNC:HGNC:443|Ensembl:ENSG00000003393|HPRD:05893|Vega:OTTHUMG00000154507
Gene type protein-coding
Map location 2q33.1
Pascal p-value 0.128
Sherlock p-value 0.107
Fetal beta 0.228
DMG 1 (# studies)
eGene Myers' cis & trans
Support CompositeSet
Darnell FMRP targets
Ascano FMRP targets

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 5

部分即遗传学nd epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg01813165 2 202646406 ALS2 8.85E-9 -0.021 4.06E-6 DMG:Jaffe_2016

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs16829545 chr2 151977407 ALS2 57679 0.01 trans
rs3845734 chr2 171125572 ALS2 57679 0.13 trans
rs7584986 chr2 184111432 ALS2 57679 0.01 trans
rs16955618 chr15 29937543 ALS2 57679 7.551E-7 trans
rs1041786 chr21 22617710 ALS2 57679 0.02 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0005085 guanyl-nucleotide exchange factor activity IDA 15247254
GO:0005087 Ran guanyl-nucleotide exchange factor activity NAS 11586298
GO:0005515 protein binding IPI 17239822
GO:0017112 Rab guanyl-nucleotide exchange factor activity IDA 12837691
去:0017137 Rab GTPase binding IDA 15247254
去:0017137 Rab GTPase binding NAS 16670179
GO:0042803 protein homodimerization activity IPI 15247254
GO:0030676 Rac guanyl-nucleotide exchange factor activity IDA 16049005
GO:0043539 protein serine/threonine kinase activator activity IDA 16049005
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0007528 neuromuscular junction development IEA Synap (GO term level: 10) -
GO:0035249 synaptic transmission, glutamatergic IEA neuron, glutamate, Synap, Neurotransmitter (GO term level: 8) -
GO:0048812 neurite morphogenesis IDA neuron, axon, neurite, dendrite (GO term level: 11) 16049005
GO:0001662 行为恐惧反应 IEA -
GO:0001881 receptor recycling IEA -
GO:0016050 vesicle organization IEA -
GO:0007626 locomotory behavior IEA -
GO:0008104 protein localization IEA -
GO:0006979 response to oxidative stress IEA -
GO:0007032 endosome organization NAS 12837691
GO:0016197 endosome transport IEA -
GO:0035022 positive regulation of Rac protein signal transduction IC 16049005
GO:0035023 regulation of Rho protein signal transduction IEA -
GO:0051036 regulation of endosome size IEP 15247254
GO:0032313 regulation of Rab GTPase activity IEA -
GO:0032855 positive regulation of Rac GTPase activity IDA 16049005
GO:0045860 positive regulation of protein kinase activity IDA 16049005
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0014069 postsynaptic density IEA Synap (GO term level: 10) -
GO:0043197 dendritic spine IEA Synap, dendrite (GO term level: 7) -
GO:0001726 ruffle ISS -
GO:0005813 centrosome IDA 16085057
GO:0005829 cytosol IDA 12837691
GO:0005622 intracellular IEA -
GO:0005737 cytoplasm IEA -
GO:0005769 early endosome IDA 12837691
GO:0030027 lamellipodium ISS -
GO:0042598 vesicular fraction IDA 12837691
GO:0043234 protein complex IDA 15247254

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG AMYOTROPHIC LATERAL SCLEROSIS ALS 53 43 All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP 612 367 All SZGR 2.0 genes in this pathway
RICKMAN METASTASIS UP 344 180 All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS DN 411 249 All SZGR 2.0 genes in this pathway
MATSUDA NATURAL KILLER DIFFERENTIATION 475 313 All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS EARLY PROGENITOR 532 309 All SZGR 2.0 genes in this pathway
KEEN RESPONSE TO ROSIGLITAZONE UP 38 23 All SZGR 2.0 genes in this pathway
YAUCH HEDGEHOG SIGNALING PARACRINE DN 264 159 All SZGR 2.0 genes in this pathway
COULOUARN TEMPORAL TGFB1 SIGNATURE UP 109 68 All SZGR 2.0 genes in this pathway
MARSON FOXP3 TARGETS DN 54 38 All SZGR 2.0 genes in this pathway
GABRIELY MIR21 TARGETS 289 187 All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE 1137 655 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-142-5p 1204 1211 1A,m8 hsa-miR-142-5p CAUAAAGUAGAAAGCACUAC
miR-144 1234 1240 m8 hsa-miR-144 UACAGUAUAGAUGAUGUACUAG
miR-199 722 729 1A,m8 hsa-miR-199a CCCAGUGUUCAGACUACCUGUUC
hsa-miR-199b CCCAGUGUUUAGACUAUCUGUUC
miR-26 448 455 1A,m8 hsa-miR-26abrain UUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZ UUCAAGUAAUUCAGGAUAGGUU
miR-505 87 94 1A,m8 hsa-miR-505 GUCAACACUUGCUGGUUUCCUC
miR-543 1245 1251 m8 hsa-miR-543 AAACAUUCGCGGUGCACUUCU