Gene Page:VAT1L
Summary?
| GeneID | 57687 |
| Symbol | VAT1L |
| Synonyms | - |
| Description | vesicle amine transport 1-like |
| Reference | HGNC:HGNC:29315|Ensembl:ENSG00000171724|HPRD:13875|Vega:OTTHUMG00000176845 |
| Gene type | protein-coding |
| Map location | 16q23.1 |
| Pascal p-value | 0.031 |
| Sherlock p-value | 0.563 |
| Fetal beta | -1.062 |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWAScat | Genome-wide Association Studies | This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb. | |
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | 系统atic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
eQTL annotation
eQTL annotation| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs12931172 | chr16 | 78138089 | VAT1L | 57687 | 0.08 | cis |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| NDUFB11 | 0.94 | 0.94 |
| PSMB4 | 0.94 | 0.95 |
| COPE | 0.92 | 0.91 |
| C12orf57 | 0.92 | 0.92 |
| EIF6 | 0.91 | 0.92 |
| FLAD1 | 0.91 | 0.91 |
| CLPP | 0.91 | 0.91 |
| MRPS34 | 0.91 | 0.90 |
| RPS27AP11 | 0.91 | 0.90 |
| DCTN3 | 0.91 | 0.94 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.26 | -0.60 | -0.75 |
| AF347015.15 | -0.58 | -0.71 |
| AF347015.8 | -0.58 | -0.69 |
| AF347015.27 | -0.57 | -0.70 |
| AF347015.2 | -0.57 | -0.71 |
| MT-CYB | -0.57 | -0.69 |
| AF347015.33 | -0.56 | -0.69 |
| MT-CO2 | -0.55 | -0.64 |
| ABCB1 | -0.55 | -0.61 |
| MT-ATP8 | -0.54 | -0.73 |
Section III. Gene Ontology annotation
| Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005488 | binding | IEA | - | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0016491 | oxidoreductase activity | IEA | - | |
| Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
| GO:0055114 | oxidation reduction | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| IVANOVA HEMATOPOIESIS STEM CELL | 254 | 164 | All SZGR 2.0 genes in this pathway |
| WANG SMARCE1 TARGETS UP | 280 | 183 | All SZGR 2.0 genes in this pathway |
| LEIN MIDBRAIN MARKERS | 82 | 55 | All SZGR 2.0 genes in this pathway |
| ZHENG GLIOBLASTOMA PLASTICITY UP | 250 | 168 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 | 349 | 234 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN NPC HCP WITH H3K27ME3 | 341 | 243 | All SZGR 2.0 genes in this pathway |
| 国外RB1增长目标 | 243 | 155 | All SZGR 2.0 genes in this pathway |
| CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124.1 | 2245 | 2252 | 1A,m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
| miR-124/506 | 2245 | 2251 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| miR-182 | 1522 | 1528 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
| miR-200bc/429 | 183 | 190 | 1A,m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
| hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
| hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
| miR-217 | 180 | 187 | 1A,m8 | hsa-miR-217 | UACUGCAUCAGGAACUGAUUGGAU |
| miR-30-5p | 2366 | 2373 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
| hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
| hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
| hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
| hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
| miR-96 | 1522 | 1528 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
| hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.