Gene Page:MARK4

Summary?
GeneID 57787
Symbol MARK4
Synonyms MARK4L|MARK4S|MARKL1|MARKL1L|PAR-1D
Description microtubule affinity regulating kinase 4
Reference MIM:606495|HGNC:HGNC:13538|Ensembl:ENSG00000007047|HPRD:09402|Vega:OTTHUMG00000181769
Gene type protein-coding
Map location 19q13.3
Pascal p-value 0.183
TADA p-value 0.002
Fetal beta -0.507
DMG 1 (# studies)
eGene Myers' cis & trans
Support CompositeSet

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Montano_2016 Genome-wide DNA methylation analysis This dataset includes 172 replicated associations between CpGs with schizophrenia. 1
DNM:Fromer_2014 Whole Exome Sequencing analysis This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA.
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 6

Section I. Genetics and epigenetics annotation

@DNM table

Gene Chromosome Position Ref Alt Transcript AA change Mutation type Sift CG46 Trait Study
MARK4 chr19 45800933 G A NM_001199867
NM_001199867
NM_031417
NM_031417		 .
.
.
.		 intronic
splice-acceptor-in2
intronic
splice-acceptor-in2		 Schizophrenia DNM:Fromer_2014

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg14114377 19 45756845 MARK4 1.07E-5 -0.008 0.045 DMG:Montano_2016

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs10994209 chr10 61877705 MARK4 57787 0.19 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
BRMS1L 0.84 0.86
FAM102B 0.83 0.83
OXCT1 0.81 0.81
VAPB 0.81 0.83
EPS15 0.81 0.81
USP12 0.80 0.80
MCFD2 0.80 0.80
SGTB 0.80 0.80
CDC40 0.80 0.78
TRAPPC6B 0.80 0.78
十大负面中的基因
Gene Pearson's Correlation Spearman's Correlation
EFEMP2 -0.39 -0.46
NUDT8 -0.38 -0.46
NDUFA4L2 -0.38 -0.41
EIF4EBP3 -0.38 -0.42
AF347015.18 -0.37 -0.30
GATSL3 -0.37 -0.43
TMEM88 -0.36 -0.43
MICALL2 -0.35 -0.37
AP003068.3 -0.35 -0.34
SLC38A5 -0.35 -0.42

Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0050321 tau-protein kinase activity IDA Brain (GO term level: 7) 14594945
GO:0050321 tau-protein kinase activity ISS Brain (GO term level: 7) -
GO:0000166 nucleotide binding IEA -
GO:0005515 protein binding 新闻学会 14594945|14676191
GO:0005524 ATP binding IEA -
GO:0005524 ATP binding NAS 15009667
GO:0004674 protein serine/threonine kinase activity IDA 15009667
GO:0004674 protein serine/threonine kinase activity IEA -
GO:0004674 protein serine/threonine kinase activity ISS -
GO:0004674 protein serine/threonine kinase activity NAS 11326310
GO:0004713 protein tyrosine kinase activity IEA -
GO:0016740 transferase activity IEA -
GO:0008017 microtubule binding IDA 14594945
GO:0008017 microtubule binding ISS -
GO:0043130 ubiquitin binding NAS 14594945
GO:0043015 gamma-tubulin binding IDA 14594945
GO:0043015 gamma-tubulin binding ISS -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0007399 nervous system development IDA neurite (GO term level: 5) 14594945
GO:0007399 nervous system development ISS neurite (GO term level: 5) -
GO:0000082 G1/S transition of mitotic cell cycle NAS 12735302
GO:0000086 G2/M transition of mitotic cell cycle NAS 11326310
GO:0001578 microtubule bundle formation IEP 14594945
GO:0001578 microtubule bundle formation ISS -
GO:0006468 protein amino acid phosphorylation IEA -
GO:0006468 protein amino acid phosphorylation NAS 11326310
GO:0006468 protein amino acid phosphorylation TAS 14594945
GO:0016055 Wnt receptor signaling pathway TAS 11326310
GO:0008284 positive regulation of cell proliferation IDA 12735302
GO:0043068 positive regulation of programmed cell death NAS 15009667
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0043005 neuron projection IDA neuron, axon, neurite, dendrite (GO term level: 5) 14594945
GO:0043005 neuron projection ISS neuron, axon, neurite, dendrite (GO term level: 5) -
GO:0000930 gamma-tubulin complex IDA 14594945
GO:0005813 centrosome IDA 14594945
GO:0005813 centrosome ISS -
GO:0005815 microtubule organizing center IDA 14594945
GO:0005874 microtubule IDA 14594945
GO:0005737 cytoplasm IDA 11326310

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
ACTA1 ACTA | ASMA | CFTD | CFTD1 | CFTDM | MPFD | NEM1 | NEM2 | NEM3 actin, alpha 1, skeletal muscle Affinity Capture-MS BioGRID 14594945
HSPA4 APG-2 | HS24/P52 | MGC131852 | RY | hsp70 | hsp70RY heat shock 70kDa protein 4 Affinity Capture-MS BioGRID 14594945
MAP2 DKFZp686I2148 | MAP2A | MAP2B | MAP2C microtubule-associated protein 2 - HPRD,BioGRID 14594945
MAP4 DKFZp779A1753 | MGC8617 microtubule-associated protein 4 - HPRD,BioGRID 14594945
MAPT DDPAC | FLJ31424 | FTDP-17 | MAPTL | MGC138549 | MSTD | MTBT1 | MTBT2 | PPND | TAU microtubule-associated protein tau - HPRD,BioGRID 14594945
MYH10 MGC134913 | MGC134914 | NMMHCB myosin, heavy chain 10, non-muscle Affinity Capture-MS BioGRID 14594945
MYH9 DFNA17 | EPSTS | FTNS | MGC104539 | MHA | NMHC-II-A | NMMHCA myosin, heavy chain 9, non-muscle Affinity Capture-MS BioGRID 14594945
STK11 LKB1 | PJS serine/threonine kinase 11 LKB1 phosphorylates MARK4. BIND 14676191
TUBA1A B-ALPHA-1 | FLJ25113 | LIS3 | TUBA3 tubulin, alpha 1a Affinity Capture-MS BioGRID 14594945
TUBB M40 | MGC117247 | MGC16435 | OK/SW-cl.56 | TUBB1 | TUBB5 tubulin, beta Affinity Capture-MS BioGRID 14594945
TUBB2A TUBB | TUBB2 | dJ40E16.7 tubulin, beta 2A - HPRD 14594945
TUBG1 TUBG | TUBGCP1 tubulin, gamma 1 Affinity Capture-MS
Affinity Capture-Western		 BioGRID 14594945


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
PID LKB1 PATHWAY 47 37 All SZGR 2.0 genes in this pathway
GARY CD5 TARGETS UP 473 314 All SZGR 2.0 genes in this pathway
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL DN 275 168 All SZGR 2.0 genes in this pathway
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC UP 185 126 All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 8HR UP 164 122 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP 1142 669 All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS 1174 695 All SZGR 2.0 genes in this pathway
ROVERSI GLIOMA COPY NUMBER UP 100 75 All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM5 94 59 All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS UP 292 168 All SZGR 2.0 genes in this pathway
BONOME OVARIAN CANCER SURVIVAL OPTIMAL DEBULKING 246 152 All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR UP 221 150 All SZGR 2.0 genes in this pathway
PURBEY CTBP1不是SATB1的目标UP 344 215 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-17-5p/20/93.mr/106/519.d 759 765 m8 hsa-miR-17-5p CAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrain UAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106a AAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZ UAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZ CAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUGU
miR-214 95 101 m8 hsa-miR-214brain ACAGCAGGCACAGACAGGCAG
miR-24 269 276 1A,m8 hsa-miR-24SZ UGGCUCAGUUCAGCAGGAACAG
miR-493-5p 765 771 1A hsa-miR-493-5p UUGUACAUGGUAGGCUUUCAUU