Gene Page:BAK1
Summary?
| GeneID | 578 |
| Symbol | BAK1 |
| Synonyms | BAK|BAK-LIKE|BCL2L7|CDN1 |
| Description | BCL2 antagonist/killer 1 |
| Reference | MIM:600516|HGNC:HGNC:949|Ensembl:ENSG00000030110|HPRD:02744|Vega:OTTHUMG00000014530 |
| Gene type | protein-coding |
| Map location | 6p21.3 |
| Pascal p-value | 1.537E-4 |
| Sherlock p-value | 0.88 |
| eGene | Cerebellar Hemisphere Cortex Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| Association | A combined odds ratio method (Sun et al. 2008), association studies | 1 | Link to SZGene |
| GSMA_I | Genome scan meta-analysis | Psr: 0.033 |
Section I. Genetics and epigenetics annotation
eQTL annotation
eQTL annotation| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs4522608 | chr2 | 122574850 | BAK1 | 578 | 0.12 | trans | ||
| rs16829545 | chr2 | 151977407 | BAK1 | 578 | 0.02 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| ZNF428 | 0.93 | 0.93 |
| RALY | 0.91 | 0.91 |
| NFKBIL1 | 0.91 | 0.89 |
| CCDC94 | 0.91 | 0.92 |
| SIRT6 | 0.90 | 0.92 |
| AC011498.3 | 0.90 | 0.91 |
| U2AF1 | 0.90 | 0.91 |
| DNAJC17 | 0.90 | 0.92 |
| NAGK | 0.89 | 0.92 |
| PRPF31 | 0.89 | 0.91 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.27 | -0.72 | -0.85 |
| AF347015.31 | -0.71 | -0.83 |
| AF347015.33 | -0.71 | -0.83 |
| MT-CO2 | -0.70 | -0.82 |
| MT-CYB | -0.70 | -0.83 |
| HLA-F | -0.68 | -0.71 |
| AF347015.8 | -0.67 | -0.82 |
| AF347015.15 | -0.67 | -0.83 |
| C5orf53 | -0.66 | -0.70 |
| AF347015.2 | -0.65 | -0.83 |
Section III. Gene Ontology annotation
| Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0042802 | identical protein binding | 新闻学会 | 15901672 | |
| GO:0046982 | protein heterodimerization activity | 新闻学会 | 10837489 | |
| Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
| GO:0001836 | release of cytochrome c from mitochondria | IDA | 9843949 | |
| GO:0006917 | induction of apoptosis | TAS | 10381623 | |
| GO:0008635 | caspase activation via cytochrome c | IEA | - | |
| GO:0010046 | response to mycotoxin | IEA | - | |
| GO:0009620 | response to fungus | IEA | - | |
| GO:0010248 | establishment or maintenance of transmembrane electrochemical gradient | IDA | 9843949 | |
| GO:0008053 | mitochondrial fusion | IEA | - | |
| GO:0042981 | regulation of apoptosis | IEA | - | |
| GO:0043496 | regulation of protein homodimerization activity | IDA | 9111042 | |
| GO:0043497 | regulation of protein heterodimerization activity | IDA | 9111042 | |
| GO:0046902 | regulation of mitochondrial membrane permeability | IDA | 9843949 | |
| GO:0051881 | regulation of mitochondrial membrane potential | IDA | 9843949 | |
| Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
| GO:0005739 | mitochondrion | IDA | 9843949 | |
| GO:0005741 | mitochondrial outer membrane | EXP | 10950869|12721291 | |
| GO:0016020 | membrane | IEA | - | |
| GO:0046930 | pore complex | IDA | 9843949 |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| ACTR2 | ARP2 | ARP2 actin-related protein 2 homolog (yeast) | Affinity Capture-MS | BioGRID | 17353931 |
| AKAP13 | AKAP-Lbc | BRX | FLJ11952 | FLJ43341 | HA-3 | Ht31 | LBC | PROTO-LB | PROTO-LBC | c-lbc | A kinase (PRKA) anchor protein 13 | Affinity Capture-MS | BioGRID | 17353931 |
| BAK1 | BAK | BAK-LIKE | BCL2L7 | CDN1 | MGC117255 | MGC3887 | BCL2-antagonist/killer 1 | Affinity Capture-Western | BioGRID | 15077116 |
| BAK1 | BAK | BAK-LIKE | BCL2L7 | CDN1 | MGC117255 | MGC3887 | BCL2-antagonist/killer 1 | BAK1 (Bak) interacts with itself to form a dimer. | BIND | 15846303 |
| BAX | BCL2L4 | BCL2-associated X protein | - | HPRD,BioGRID | 11571294 |
| BCL2 | Bcl-2 | B-cell CLL/lymphoma 2 | - | HPRD,BioGRID | 11728179 |
| BCL2A1 | ACC-1 | ACC-2 | BCL2L5 | BFL1 | GRS | HBPA1 | BCL2-related protein A1 | - | HPRD | 10381646 |
| BCL2L1 | BCL-XL/S | BCL2L | BCLX | Bcl-X | DKFZp781P2092 | bcl-xL | bcl-xS | BCL2-like 1 | - | HPRD,BioGRID | 11175750 |
| BCL2L2 | BCL-W | BCLW | KIAA0271 | BCL2-like 2 | Affinity Capture-Western | BioGRID | 10381646 |
| BID | FP497 | MGC15319 | MGC42355 | BH3 interacting domain death agonist | - | HPRD | 10950869 |
| DFFA | DFF-45 | DFF1 | ICAD | DNA fragmentation factor, 45kDa, alpha polypeptide | Affinity Capture-MS | BioGRID | 17353931 |
| FBL | FIB | FLRN | RNU3IP1 | fibrillarin | Affinity Capture-MS | BioGRID | 17353931 |
| FRYL | DKFZp686E205 | FLJ16177 | KIAA0826 | FRY-like | Affinity Capture-MS | BioGRID | 17353931 |
| HSPD1 | CPN60 | GROEL | HSP60 | HSP65 | HuCHA60 | SPG13 | heat shock 60kDa protein 1 (chaperonin) | - | HPRD,BioGRID | 12070120 |
| KRT31 | HA1 | Ha-1 | KRTHA1 | MGC138630 | hHa1 | keratin 31 | Affinity Capture-MS | BioGRID | 17353931 |
| MCL1 | BCL2L3 | EAT | MCL1L | MCL1S | MGC104264 | MGC1839 | TM | myeloid cell leukemia sequence 1 (BCL2-related) | - | HPRD | 10579309|10837489 |
| MCL1 | BCL2L3 | EAT | MCL1L | MCL1S | MGC104264 | MGC1839 | TM | myeloid cell leukemia sequence 1 (BCL2-related) | Affinity Capture-Western Protein-peptide Reconstituted Complex Two-hybrid |
BioGRID | 10837489|15077116 |15637055|15901672 |
| MYCBP2 | DKFZp686M08244 | FLJ10106 | FLJ13826 | FLJ21597 | FLJ21646 | KIAA0916 | PAM | MYC binding protein 2 | Affinity Capture-MS | BioGRID | 17353931 |
| SRRM2 | 300-KD | CWF21 | DKFZp686O15166 | FLJ21926 | FLJ22250 | KIAA0324 | MGC40295 | SRL300 | SRm300 | serine/arginine repetitive matrix 2 | Affinity Capture-MS | BioGRID | 17353931 |
| TP53 | FLJ92943 | LFS1 | TRP53 | p53 | tumor protein p53 | Mitochondrial p53-P72 interacts with Bak. | BIND | 15077116 |
| TP53 | FLJ92943 | LFS1 | TRP53 | p53 | tumor protein p53 | Mitochondrial p53-R72 interacts with Bak. | BIND | 15077116 |
| TP53 | FLJ92943 | LFS1 | TRP53 | p53 | tumor protein p53 | Affinity Capture-MS Affinity Capture-Western Reconstituted Complex |
BioGRID | 15077116 |
| VDAC2 | FLJ23841 | voltage-dependent anion channel 2 | - | HPRD,BioGRID | 12881569 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| BIOCARTA MITOCHONDRIA PATHWAY | 21 | 15 | All SZGR 2.0 genes in this pathway |
| SA PROGRAMMED CELL DEATH | 12 | 9 | All SZGR 2.0 genes in this pathway |
| ST FAS SIGNALING PATHWAY | 65 | 54 | All SZGR 2.0 genes in this pathway |
| PID P73PATHWAY | 79 | 59 | All SZGR 2.0 genes in this pathway |
| PID P53 DOWNSTREAM PATHWAY | 137 | 94 | All SZGR 2.0 genes in this pathway |
| REACTOME APOPTOSIS | 148 | 94 | All SZGR 2.0 genes in this pathway |
| REACTOME INTRINSIC PATHWAY FOR APOPTOSIS | 30 | 21 | All SZGR 2.0 genes in this pathway |
| KIM WT1 TARGETS 12HR UP | 162 | 116 | All SZGR 2.0 genes in this pathway |
| ELVIDGE HYPOXIA DN | 146 | 94 | All SZGR 2.0 genes in this pathway |
| CONCANNON APOPTOSIS BY EPOXOMICIN UP | 239 | 157 | All SZGR 2.0 genes in this pathway |
| WANG ESOPHAGUS CANCER VS NORMAL UP | 121 | 72 | All SZGR 2.0 genes in this pathway |
| MARKS HDAC TARGETS UP | 23 | 15 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 TTD UP | 64 | 39 | All SZGR 2.0 genes in this pathway |
| GALLUZZI PERMEABILIZE MITOCHONDRIA | 43 | 31 | All SZGR 2.0 genes in this pathway |
| GALLUZZI PREVENT MITOCHONDIAL PERMEABILIZATION | 22 | 16 | All SZGR 2.0 genes in this pathway |
| PATIL LIVER CANCER | 747 | 453 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 UP | 309 | 199 | All SZGR 2.0 genes in this pathway |
| RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY DN | 382 | 224 | All SZGR 2.0 genes in this pathway |
| RICKMAN METASTASIS DN | 261 | 155 | All SZGR 2.0 genes in this pathway |
| ZEILSTRA CD44 TARGETS DN | 7 | 5 | All SZGR 2.0 genes in this pathway |
| STANELLE E2F1 TARGETS | 29 | 20 | All SZGR 2.0 genes in this pathway |
| KANNAN TP53 TARGETS UP | 58 | 40 | All SZGR 2.0 genes in this pathway |
| FRASOR RESPONSE TO ESTRADIOL DN | 82 | 52 | All SZGR 2.0 genes in this pathway |
| TENEDINI MEGAKARYOCYTE MARKERS | 66 | 48 | All SZGR 2.0 genes in this pathway |
| TARTE PLASMA CELL VS PLASMABLAST DN | 309 | 206 | All SZGR 2.0 genes in this pathway |
| DER IFN GAMMA RESPONSE UP | 71 | 45 | All SZGR 2.0 genes in this pathway |
| AFFAR YY1 TARGETS UP | 214 | 133 | All SZGR 2.0 genes in this pathway |
| WEIGEL OXIDATIVE STRESS BY TBH AND H2O2 | 36 | 24 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 20HR UP | 240 | 152 | All SZGR 2.0 genes in this pathway |
| TAKAO RESPONSE TO UVB RADIATION UP | 86 | 55 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 16HR UP | 225 | 139 | All SZGR 2.0 genes in this pathway |
| 击倒卡路里限制肌肉DN | 87 | 59 | All SZGR 2.0 genes in this pathway |
| MACLACHLAN BRCA1 TARGETS DN | 16 | 12 | All SZGR 2.0 genes in this pathway |
| MOREIRA RESPONSE TO TSA UP | 28 | 23 | All SZGR 2.0 genes in this pathway |
| BRACHAT RESPONSE TO CAMPTOTHECIN DN | 46 | 31 | All SZGR 2.0 genes in this pathway |
| MAHAJAN RESPONSE TO IL1A UP | 81 | 52 | All SZGR 2.0 genes in this pathway |
| FOSTER TOLERANT MACROPHAGE UP | 156 | 92 | All SZGR 2.0 genes in this pathway |
| BLUM RESPONSE TO SALIRASIB UP | 245 | 159 | All SZGR 2.0 genes in this pathway |
| MUELLER PLURINET | 299 | 189 | All SZGR 2.0 genes in this pathway |
| MOOTHA HUMAN MITODB 6 2002 | 429 | 260 | All SZGR 2.0 genes in this pathway |
| MOOTHA MITOCHONDRIA | 447 | 277 | All SZGR 2.0 genes in this pathway |
| ZHANG TLX TARGETS 36HR UP | 221 | 150 | All SZGR 2.0 genes in this pathway |
| YAMASHITA LIVER CANCER STEM CELL UP | 47 | 38 | All SZGR 2.0 genes in this pathway |
| FONTAINE PAPILLARY THYROID CARCINOMA DN | 80 | 53 | All SZGR 2.0 genes in this pathway |
| 磨破SCHECH TUMOR EVASION AND TOLEROGENICITY DN | 14 | 11 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN ES ICP WITH H3K4ME3 | 718 | 401 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN NPC ICP WITH H3K4ME3 | 445 | 257 | All SZGR 2.0 genes in this pathway |
| DUTERTRE ESTRADIOL RESPONSE 6HR DN | 91 | 56 | All SZGR 2.0 genes in this pathway |
| DUTERTRE ESTRADIOL RESPONSE 24HR DN | 505 | 328 | All SZGR 2.0 genes in this pathway |
| PURBEY TARGETS OF CTBP1 NOT SATB1 DN | 448 | 282 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
| FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-125/351 | 630 | 637 | 1A,m8 | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
| hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG | ||||
| miR-26 | 1032 | 1039 | 1A,m8 | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
| hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
| miR-29 | 188 | 195 | 1A,m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
| hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
| hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.