Gene Page:PTPRA

总和mary?
GeneID 5786
Symbol PTPRA
Synonyms HEPTP|HLPR|HPTPA|HPTPalpha|LRP|PTPA|PTPRL2|R-PTP-alpha|RPTPA
Description protein tyrosine phosphatase, receptor type A
Reference MIM:176884|HGNC:HGNC:9664|Ensembl:ENSG00000132670|HPRD:01476|Vega:OTTHUMG00000031718
Gene type protein-coding
Map location 20p13
Pascal p-value 0.036
Sherlock p-value 5.53E-4
Fetal beta 0.571
DMG 1 (# studies)
eGene Myers' cis & trans
Support TYROSINE KINASE SIGNALING

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 2
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search 与精神分裂症Co-occurance关键词:schizophrenia,schizophrenic,schizophrenias Click to show details
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 0.0261

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg01048080 20 2853896 PTPRA 2.63E-8 -0.009 8.4E-6 DMG:Jaffe_2016
cg21457839 20 2854634 PTPRA 5.83E-8 -0.009 1.49E-5 DMG:Jaffe_2016

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs879725 chr1 244406045 PTPRA 5786 0.15 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
PIP5K1C 0.90 0.89
ABR 0.89 0.90
UNC13A 0.89 0.89
RHOBTB2 0.89 0.89
CLSTN1 0.87 0.88
PITPNM2 0.87 0.83
CHD5 0.87 0.85
TLN2 0.87 0.86
GARNL4 0.87 0.85
RIMBP2 0.86 0.84
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.21 -0.49 -0.50
C1orf54 -0.48 -0.57
GNG11 -0.48 -0.56
C1orf61 -0.45 -0.52
AP002478.3 -0.44 -0.48
AF347015.31 -0.43 -0.47
RPS27L -0.43 -0.45
SYCP3 -0.42 -0.50
CLEC2B -0.42 -0.48
SAT1 -0.42 -0.49

Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0005001 transmembrane receptor protein tyrosine phosphatase activity TAS 2169617
GO:0004872 receptor activity IEA -
GO:0016787 hydrolase activity IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0006468 protein amino acid phosphorylation IEA -
GO:0006470 protein amino acid dephosphorylation IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0016020 membrane IEA -
GO:0005887 integral to plasma membrane TAS 2169617

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
BIOCARTA SRCRPTP PATHWAY 11 9 All SZGR 2.0 genes in this pathway
ST WNT BETA CATENIN PATHWAY 34 28 All SZGR 2.0 genes in this pathway
PID INSULIN PATHWAY 45 32 All SZGR 2.0 genes in this pathway
PID INTEGRIN A4B1 PATHWAY 33 24 All SZGR 2.0 genes in this pathway
PARENT MTOR SIGNALING UP 567 375 All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA UP 783 507 All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP 1382 904 All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS DN 508 354 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
RASHI RESPONSE TO IONIZING RADIATION 2 127 92 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN 855 609 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN 483 336 All SZGR 2.0 genes in this pathway
PENG GLUTAMINE DEPRIVATION UP 38 25 All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS 882 572 All SZGR 2.0 genes in this pathway
MOOTHA HUMAN MITODB 6 2002 429 260 All SZGR 2.0 genes in this pathway
MOOTHA MITOCHONDRIA 447 277 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS DN 366 257 All SZGR 2.0 genes in this pathway
霍夫曼PRE BI大前BII淋巴细胞 36 24 All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA CHEMOTAXIS DN 457 302 All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA CLASSES UP 605 377 All SZGR 2.0 genes in this pathway
NAKAMURA ADIPOGENESIS LATE UP 104 67 All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA CLASSICAL 162 122 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-1/206 311 317 1A hsa-miR-1 UGGAAUGUAAAGAAGUAUGUA
hsa-miR-206SZ UGGAAUGUAAGGAAGUGUGUGG
hsa-miR-613 AGGAAUGUUCCUUCUUUGCC
miR-146 352 359 1A,m8 hsa-miR-146a UGAGAACUGAAUUCCAUGGGUU
hsa-miR-146bbrain UGAGAACUGAAUUCCAUAGGCU
miR-218 344 351 1A,m8 hsa-miR-218brain UUGUGCUUGAUCUAACCAUGU
miR-495 59 65 1A hsa-miR-495brain AAACAAACAUGGUGCACUUCUUU
miR-496 151 157 1A hsa-miR-496 AUUACAUGGCCAAUCUC