Gene Page:PTPRE

Summary?
GeneID 5791
Symbol PTPRE
Synonyms HPTPE|PTPE|R-PTP-EPSILON
Description protein tyrosine phosphatase, receptor type E
Reference MIM:600926|HGNC:HGNC:9669|Ensembl:ENSG00000132334|HPRD:02956|Vega:OTTHUMG00000019254
Gene type protein-coding
Map location 10q26
Pascal p-value 0.061
Fetal beta -1.296
eGene Cerebellum

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.03487
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias Click to show details

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0005001 transmembrane receptor protein tyrosine phosphatase activity TAS 2170109
GO:0004872 receptor activity IEA -
GO:0016787 hydrolase activity IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0006468 protein amino acid phosphorylation IEA -
GO:0006470 protein amino acid dephosphorylation TAS 2170109
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005737 细胞质 IEA -
GO:0016021 integral to membrane IEA -
GO:0005886 plasma membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
PID IL6 7 PATHWAY 47 40 All SZGR 2.0 genes in this pathway
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP 255 177 All SZGR 2.0 genes in this pathway
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA UP 177 110 All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA DN 116 79 All SZGR 2.0 genes in this pathway
OSMAN BLADDER CANCER DN 406 230 All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS UP 214 155 All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE UP 530 342 All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER UP 443 294 All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 3 DN 229 142 All SZGR 2.0 genes in this pathway
BERENJENO通过RHOA转换 536 340 All SZGR 2.0 genes in this pathway
TANAKA METHYLATED IN ESOPHAGEAL CARCINOMA 103 58 All SZGR 2.0 genes in this pathway
ROVERSI GLIOMA COPY NUMBER DN 54 37 All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM1 229 137 All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM2 153 102 All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN 584 395 All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215 893 528 All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 DN 464 276 All SZGR 2.0 genes in this pathway
LEE LIVER CANCER DENA UP 60 40 All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS DN 366 238 All SZGR 2.0 genes in this pathway
GALINDO IMMUNE RESPONSE TO ENTEROTOXIN 85 67 All SZGR 2.0 genes in this pathway
HADDAD B LYMPHOCYTE PROGENITOR 293 193 All SZGR 2.0 genes in this pathway
THEILGAARD NEUTROPHIL AT SKIN WOUND UP 77 52 All SZGR 2.0 genes in this pathway
低音部CD40 SIGNALING UP 101 76 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 20HR UP 240 152 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 16HR UP 225 139 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN 1237 837 All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY UP 487 303 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 10HR UP 101 69 All SZGR 2.0 genes in this pathway
《图片报》极品癌基因IC SIGNATURE 261 166 All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP 953 554 All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP 783 442 All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 720 440 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP 673 430 All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN 593 372 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN 591 366 All SZGR 2.0 genes in this pathway
ACEVEDO METHYLATED IN LIVER CANCER DN 940 425 All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL DN 216 143 All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C D DN 252 155 All SZGR 2.0 genes in this pathway
SEKI INFLAMMATORY RESPONSE LPS UP 77 56 All SZGR 2.0 genes in this pathway
LINDSTEDT DENDRITIC CELL MATURATION D 68 44 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR UP 221 150 All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 60HR UP 293 203 All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS UP 108 78 All SZGR 2.0 genes in this pathway
汉SATB1 DN的目标 442 275 All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK 1210 725 All SZGR 2.0 genes in this pathway
YAGI AML WITH INV 16 TRANSLOCATION 422 277 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 491 319 All SZGR 2.0 genes in this pathway
SENGUPTA EBNA1 ANTICORRELATED 173 85 All SZGR 2.0 genes in this pathway
SASSON RESPONSE TO GONADOTROPHINS DN 87 66 All SZGR 2.0 genes in this pathway
SASSON RESPONSE TO FORSKOLIN DN 88 68 All SZGR 2.0 genes in this pathway
WANG RESPONSE TO GSK3 INHIBITOR SB216763 DN 374 217 All SZGR 2.0 genes in this pathway
LU EZH2 TARGETS DN 414 237 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 UP 430 288 All SZGR 2.0 genes in this pathway
BAKKER FOXO3 TARGETS DN 187 109 All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS UP 682 433 All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN 1080 713 All SZGR 2.0 genes in this pathway
RATTENBACHER BOUND BY CELF1 467 251 All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP 489 314 All SZGR 2.0 genes in this pathway
GHANDHI DIRECT IRRADIATION UP 110 68 All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF 516 308 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-124.1 8 15 1A,m8 hsa-miR-124a UUAAGGCACGCGGUGAAUGCCA
miR-124/506 8 14 1A hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brain UAAGGCACGCGGUGAAUGCC
miR-142-5p 2775 2781 1A hsa-miR-142-5p CAUAAAGUAGAAAGCACUAC
miR-185 2573 2580 1A,m8 hsa-miR-185brain UGGAGAGAAAGGCAGUUC
miR-192/215 192 198 1A hsa-miR-192 CUGACCUAUGAAUUGACAGCC
hsa-miR-215 AUGACCUAUGAAUUGACAGAC
miR-381 103 109 1A hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU
miR-495 113 119 1A hsa-miR-495brain AAACAAACAUGGUGCACUUCUUU