Gene Page:PVALB

Summary?
GeneID 5816
Symbol PVALB
Synonyms D22S749
Description parvalbumin
Reference MIM:168890|HGNC:HGNC:9704|Ensembl:ENSG00000100362|HPRD:01353|Vega:OTTHUMG00000150547
Gene type protein-coding
Map location 22q13.1
Pascal p-value 0.006
Fetal beta -3.238
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search 系统搜索PubMed co-o基因ccurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs1940436 chr18 415400 PVALB 5816 0.1 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005509 calcium ion binding IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0030424 axon IEA neuron, axon, Neurotransmitter (GO term level: 6) -
GO:0005737 cytoplasm IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
DAVICIONI MOLECULAR ARMS VS ERMS DN 182 111 All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 1 DN 378 231 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP 1142 669 All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP 612 367 All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK 1652 1023 All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK 1442 892 All SZGR 2.0 genes in this pathway
PUJANA CHEK2 PCC NETWORK 779 480 All SZGR 2.0 genes in this pathway
COWLING MYCN TARGETS 43 27 All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS 957 597 All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL AND BRAIN QTL TRANS 185 114 All SZGR 2.0 genes in this pathway
SHEPARD BMYB MORPHOLINO DN 200 112 All SZGR 2.0 genes in this pathway
FRASOR RESPONSE TO ESTRADIOL DN 82 52 All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS MATURE CELL 293 160 All SZGR 2.0 genes in this pathway
WESTON VEGFA TARGETS 6HR 59 38 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR DN 504 323 All SZGR 2.0 genes in this pathway
WESTON VEGFA TARGETS 108 71 All SZGR 2.0 genes in this pathway
PAL PRMT5 TARGETS DN 29 16 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER LUMINAL B UP 172 109 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN 701 446 All SZGR 2.0 genes in this pathway
ZHENG GLIOBLASTOMA PLASTICITY DN 58 39 All SZGR 2.0 genes in this pathway
BHATI G2M ARREST BY 2METHOXYESTRADIOL DN 127 75 All SZGR 2.0 genes in this pathway
YAUCH HEDGEHOG SIGNALING PARACRINE DN 264 159 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 ICP WITH H3K27ME3 74 46 All SZGR 2.0 genes in this pathway
MIKKELSEN MEF ICP WITH H3K27ME3 206 108 All SZGR 2.0 genes in this pathway
KYNG WERNER SYNDROM AND NORMAL AGING DN 225 124 All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3 AND H3K27ME3 137 85 All SZGR 2.0 genes in this pathway
MIKKELSEN NPC ICP WITH H3K27ME3 12 8 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 30MIN DN 150 99 All SZGR 2.0 genes in this pathway
YANG BCL3 TARGETS UP 364 236 All SZGR 2.0 genes in this pathway
LIM MAMMARY LUMINAL MATURE UP 116 65 All SZGR 2.0 genes in this pathway
CHEMELLO SOLEUS VS EDL MYOFIBERS DN 19 10 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-338 155 162 1A,m8 hsa-miR-338brain UCCAGCAUCAGUGAUUUUGUUGA