Gene Page:PRUNE

Summary?
GeneID 58497
Symbol PRUNE
Synonyms DRES-17|DRES17|HTCD37
Description prune exopolyphosphatase
Reference HGNC:HGNC:13420|Ensembl:ENSG00000143363|HPRD:15188|Vega:OTTHUMG00000035062
Gene type protein-coding
Map location 1q21
Sherlock p-value 0.058
Fetal beta 0.034
DMG 1 (# studies)

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Nishioka_2013 Genome-wide DNA methylation analysis The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. 1
PMID:cooccur High-throughput literature-search 系统搜索PubMed通用电气nes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I Genome scan meta-analysis Psr: 0.0235
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.00814
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg19744131 1 150980805 PRUNE -0.019 0.77 DMG:Nishioka_2013


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
STK25 0.88 0.86
SLC35B1 0.87 0.81
C11orf49 0.87 0.84
IFNGR2 0.86 0.81
PREB 0.85 0.82
EMD 0.85 0.82
RABGGTA 0.85 0.82
ERAL1 0.85 0.82
MCRS1 0.85 0.81
C14orf1 0.84 0.82
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.8 -0.69 -0.65
MT-CO2 -0.68 -0.61
AF347015.27 -0.68 -0.65
AF347015.26 -0.67 -0.66
AF347015.33 -0.67 -0.62
AF347015.21 -0.67 -0.64
AF347015.18 -0.66 -0.70
AL139819.3 -0.65 -0.63
AF347015.31 -0.64 -0.59
MT-ATP8 -0.64 -0.68

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0004427 inorganic diphosphatase activity IEA -
GO:0016787 hydrolase activity IEA -
GO:0016462 pyrophosphatase activity IEA -
GO:0030145 manganese ion binding IEA -
GO:0046872 metal ion binding IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005634 nucleus IEA -
GO:0005737 cytoplasm IEA -
GO:0030054 cell junction IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG PURINE METABOLISM 159 96 All SZGR 2.0 genes in this pathway
PARENT MTOR SIGNALING UP 567 375 All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA UP 783 507 All SZGR 2.0 genes in this pathway
THUM SYSTOLIC HEART FAILURE UP 423 283 All SZGR 2.0 genes in this pathway
GAL LEUKEMIC STEM CELL DN 244 153 All SZGR 2.0 genes in this pathway
OSMAN BLADDER CANCER DN 406 230 All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP 1278 748 All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 1 DN 378 231 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
PATIL LIVER CANCER 747 453 All SZGR 2.0 genes in this pathway
MOHANKUMAR TLX1 TARGETS UP 414 287 All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK 1442 892 All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS DN 1024 594 All SZGR 2.0 genes in this pathway
ROSS AML OF FAB M7 TYPE 68 44 All SZGR 2.0 genes in this pathway
YAGI AML SURVIVAL 129 87 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 14HR UP 156 101 All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY NO BLOOD UP 222 139 All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY UP 487 303 All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED 1022 619 All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED 1229 713 All SZGR 2.0 genes in this pathway
LIN MELANOMA COPY NUMBER UP 73 53 All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS UP 395 249 All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK 1210 725 All SZGR 2.0 genes in this pathway
COULOUARN TEMPORAL TGFB1 SIGNATURE UP 109 68 All SZGR 2.0 genes in this pathway
FONTAINE FOLLICULAR THYROID ADENOMA UP 75 43 All SZGR 2.0 genes in this pathway
FONTAINE PAPILLARY THYROID CARCINOMA DN 80 53 All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA UP 207 143 All SZGR 2.0 genes in this pathway
RAGHAVACHARI PLATELET SPECIFIC GENES 70 46 All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN 1080 713 All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D 658 397 All SZGR 2.0 genes in this pathway
ROESSLER LIVER CANCER METASTASIS DN 53 29 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY 1839 928 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-9 1403 1409 m8 hsa-miR-9SZ UCUUUGGUUAUCUAGCUGUAUGA