Gene Page:RALB

Summary?
GeneID 5899
Symbol RALB
Synonyms -
Description v-ral simian leukemia viral oncogene homolog B
Reference MIM:179551|HGNC:HGNC:9840|Ensembl:ENSG00000144118|HPRD:01550|Vega:OTTHUMG00000131435
Gene type protein-coding
Map location 2q14.2
Pascal p-value 0.122
DEG p-value DEG:Zhao_2015:p=5.18e-05:q=0.0489
Fetal beta -0.837
DMG 1 (# studies)
eGene Myers' cis & trans
元

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DEG:Zhao_2015 RNA Sequencing analysis Transcriptome sequencing and genome-wide association analyses reveal lysosomal function and actin cytoskeleton remodeling in schizophrenia and bipolar disorder.
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1
GSMA_I Genome scan meta-analysis Psr: 0.023
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.00755
Expression 元-analysis of gene expression Pvalue: 1.457

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg17169613 2 121010068 RALB 2.26E-8 -0.012 7.55E-6 DMG:Jaffe_2016

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs1578978 chr8 118196802 RALB 5899 0.1 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
VPS45 0.86 0.85
SMU1 0.85 0.82
C15orf44 0.84 0.81
ANAPC7 0.84 0.81
ALDH3A2 0.84 0.81
MBIP 0.83 0.82
CNBP 0.83 0.79
EIF2AK1 0.83 0.76
SNX2 0.83 0.79
ZC3H14 0.82 0.79
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.21 -0.75 -0.63
MT-CO2 -0.73 -0.66
AF347015.8 -0.71 -0.65
AF347015.31 -0.70 -0.65
MT-CYB -0.69 -0.63
AF347015.2 -0.68 -0.63
IFI27 -0.67 -0.64
AF347015.27 -0.67 -0.63
AF347015.15 -0.66 -0.64
AF347015.33 -0.66 -0.60

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0000166 nucleotide binding IEA -
GO:0005515 protein binding 新闻学会 7673236
GO:0005525 GTP binding IEA -
GO:0005525 GTP binding TAS 2120779
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007265 Ras protein signal transduction EXP 11520933
GO:0007264 small GTPase mediated signal transduction IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005622 intracellular IEA -
GO:0005886 plasma membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG PATHWAYS IN CANCER 328 259 All SZGR 2.0 genes in this pathway
KEGG PANCREATIC CANCER 70 56 All SZGR 2.0 genes in this pathway
PID P38 ALPHA BETA PATHWAY 31 25 All SZGR 2.0 genes in this pathway
PID CXCR4 PATHWAY 102 78 All SZGR 2.0 genes in this pathway
PID FOXO PATHWAY 49 43 All SZGR 2.0 genes in this pathway
REACTOME SIGNALLING BY NGF 217 167 All SZGR 2.0 genes in this pathway
REACTOME SIGNALLING TO RAS 27 23 All SZGR 2.0 genes in this pathway
REACTOME NGF SIGNALLING VIA TRKA FROM THE PLASMA MEMBRANE 137 105 All SZGR 2.0 genes in this pathway
REACTOME SIGNALLING TO ERKS 36 30 All SZGR 2.0 genes in this pathway
REACTOME P38MAPK EVENTS 13 12 All SZGR 2.0 genes in this pathway
THUM SYSTOLIC HEART FAILURE UP 423 283 All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP 1382 904 All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL DN 455 304 All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS UP 293 179 All SZGR 2.0 genes in this pathway
WANG BARRETTS ESOPHAGUS UP 51 27 All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 2B 392 251 All SZGR 2.0 genes in this pathway
GRUETZMANN PANCREATIC CANCER UP 358 245 All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN 584 395 All SZGR 2.0 genes in this pathway
ALCALA APOPTOSIS 88 60 All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP 424 268 All SZGR 2.0 genes in this pathway
LEE LIVER CANCER MYC UP 54 30 All SZGR 2.0 genes in this pathway
LEE LIVER CANCER MYC TGFA UP 61 40 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN 1237 837 All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN 830 547 All SZGR 2.0 genes in this pathway
KAYO AGING MUSCLE UP 244 165 All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV SCC UP 123 75 All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP 566 371 All SZGR 2.0 genes in this pathway
DURCHDEWALD SKIN CARCINOGENESIS DN 264 168 All SZGR 2.0 genes in this pathway
YAGI AML WITH T 8 21 TRANSLOCATION 368 247 All SZGR 2.0 genes in this pathway
OKAMOTO LIVER CANCER MULTICENTRIC OCCURRENCE UP 25 15 All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SUBCLASS S1 237 159 All SZGR 2.0 genes in this pathway
CHYLA CBFA2T3 TARGETS UP 387 225 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN 321 200 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-203.1 1280 1287 1A,m8 hsa-miR-203 UGAAAUGUUUAGGACCACUAG
miR-9 1403 1409 1A hsa-miR-9SZ UCUUUGGUUAUCUAGCUGUAUGA