Gene Page:RANBP1

Summary?
GeneID 5902
Symbol RANBP1
Synonyms HTF9A
Description RAN binding protein 1
Reference MIM:601180|HGNC:HGNC:9847|Ensembl:ENSG00000099901|HPRD:03110|Vega:OTTHUMG00000150490
Gene type protein-coding
地图上的位置 22q11.21
Pascal p-value 3.271E-4
Sherlock p-value 0.866
Fetal beta 0.458
DMG 1 (# studies)
eGene Myers' cis & trans
Meta

Gene in Data Sources
Gene set name Method of gene set Description Info
CNV:YES 复制number variation studies Manual curation
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Association A combined odds ratio method (Sun et al. 2008), association studies 2 链接到SZGene
GSMA_I Genome scan meta-analysis Psr: 0.031
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 0.0044

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

探针 Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg01985090 22 20104996 RANBP1 1.03E-8 -0.01 4.45E-6 DMG:Jaffe_2016

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs443832 chr16 83779643 RANBP1 5902 0.16 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
C17orf80 0.92 0.93
ZC3H11A 0.92 0.92
ZC3H7A 0.92 0.92
MED23 0.91 0.94
TTC37 0.91 0.92
VPS54 0.91 0.92
NEK4 0.90 0.92
HEATR6 0.90 0.91
GTF2I 0.90 0.92
ADAM17 0.90 0.93
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
MT-CO2 -0.76 -0.82
AF347015.31 -0.76 -0.82
AF347015.21 -0.76 -0.84
IFI27 -0.74 -0.78
AF347015.27 -0.73 -0.79
AF347015.8 -0.71 -0.79
HIGD1B -0.71 -0.78
FXYD1 -0.71 -0.76
MT-CYB -0.70 -0.76
AF347015.33 -0.70 -0.76

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005096 GTPase activator activity IEA -
GO:0005092 GDP-dissociation inhibitor activity TAS 7616957
GO:0005515 protein binding 新闻学会 17353931
GO:0008536 Ran GTPase binding TAS 7882974
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007165 signal transduction TAS 16130169
GO:0007051 spindle organization IEA -
GO:0046907 intracellular transport IEA -
GO:0046604 positive regulation of mitotic centrosome separation IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005813 中心体 IEA -
GO:0005634 nucleus TAS 16130169
GO:0005737 cytoplasm TAS 16130169

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
BIOCARTA RANMS PATHWAY 10 7 All SZGR 2.0 genes in this pathway
PID E2F PATHWAY 74 48 All SZGR 2.0 genes in this pathway
REACTOME HIV INFECTION 207 122 All SZGR 2.0 genes in this pathway
REACTOME HIV LIFE CYCLE 125 69 All SZGR 2.0 genes in this pathway
REACTOME HOST INTERACTIONS OF HIV FACTORS 132 81 All SZGR 2.0 genes in this pathway
REACTOME LATE PHASE OF HIV LIFE CYCLE 104 61 All SZGR 2.0 genes in this pathway
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP 579 346 All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP 1382 904 All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER EARLY UP 430 232 All SZGR 2.0 genes in this pathway
ODONNELL TFRC TARGETS DN 139 76 All SZGR 2.0 genes in this pathway
ODONNELL TARGETS OF MYC AND TFRC DN 45 25 All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP 1278 748 All SZGR 2.0 genes in this pathway
GRAHAM CML DIVIDING VS NORMAL QUIESCENT UP 181 101 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN 1375 806 All SZGR 2.0 genes in this pathway
MARKEY RB1 ACUTE LOF DN 228 137 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
OUELLET OVARIAN CANCER INVASIVE VS LMP UP 117 85 All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA UP 536 340 All SZGR 2.0 genes in this pathway
MISSIAGLIA REGULATED BY METHYLATION DN 122 67 All SZGR 2.0 genes in this pathway
EBAUER TARGETS OF PAX3 FOXO1 FUSION UP 207 128 All SZGR 2.0 genes in this pathway
SCHLOSSER MYC TARGETS REPRESSED BY SERUM 159 93 All SZGR 2.0 genes in this pathway
TSAI RESPONSE TO IONIZING RADIATION 149 101 All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK 1652 1023 All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK 1442 892 All SZGR 2.0 genes in this pathway
PUJANA CHEK2 PCC NETWORK 779 480 All SZGR 2.0 genes in this pathway
CAFFAREL RESPONSE TO THC 24HR 5 DN 59 35 All SZGR 2.0 genes in this pathway
BENPORATH PROLIFERATION 147 80 All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION DN 517 309 All SZGR 2.0 genes in this pathway
STARK HYPPOCAMPUS 22Q11 DELETION DN 20 19 All SZGR 2.0 genes in this pathway
MORI EMU MYC LYMPHOMA BY ONSET TIME UP 110 69 All SZGR 2.0 genes in this pathway
MANALO HYPOXIA DN 289 166 All SZGR 2.0 genes in this pathway
SCHUHMACHER MYC TARGETS UP 80 57 All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA SUBGROUPS 30 20 All SZGR 2.0 genes in this pathway
MATSUDA NATURAL KILLER DIFFERENTIATION 475 313 All SZGR 2.0 genes in this pathway
FERRANDO T ALL WITH MLL ENL FUSION DN 87 57 All SZGR 2.0 genes in this pathway
ALCALAY AML BY NPM1 LOCALIZATION DN 184 132 All SZGR 2.0 genes in this pathway
LY AGING PREMATURE DN 30 17 All SZGR 2.0 genes in this pathway
击倒卡路里限制肌肉DN 87 59 All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK UP 244 151 All SZGR 2.0 genes in this pathway
ZHU CMV ALL UP 120 89 All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 UP 428 266 All SZGR 2.0 genes in this pathway
ZHU CMV 24 HR UP 93 65 All SZGR 2.0 genes in this pathway
DAZARD UV RESPONSE CLUSTER G1 67 41 All SZGR 2.0 genes in this pathway
LY AGING OLD DN 56 35 All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN 911 527 All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN 1011 592 All SZGR 2.0 genes in this pathway
MARSON BOUND BY E2F4 UNSTIMULATED 728 415 All SZGR 2.0 genes in this pathway
DAIRKEE CANCER PRONE RESPONSE BPA 51 35 All SZGR 2.0 genes in this pathway
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP 863 514 All SZGR 2.0 genes in this pathway
ZHANG BREAST CANCER PROGENITORS DN 145 93 All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP 871 505 All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB DN 342 220 All SZGR 2.0 genes in this pathway
KOBAYASHI EGFR SIGNALING 24HR DN 251 151 All SZGR 2.0 genes in this pathway
FOURNIER ACINAR DEVELOPMENT LATE 2 277 172 All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA CLASSES UP 605 377 All SZGR 2.0 genes in this pathway
WINNEPENNINCKX MELANOMA METASTASIS UP 162 86 All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 14 143 86 All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS SENESCENT 572 352 All SZGR 2.0 genes in this pathway
WANG RESPONSE TO GSK3 INHIBITOR SB216763 DN 374 217 All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS DN 882 538 All SZGR 2.0 genes in this pathway
ZHOU CELL CYCLE GENES IN IR RESPONSE 6HR 85 49 All SZGR 2.0 genes in this pathway
ZHOU CELL CYCLE GENES IN IR RESPONSE 24HR 128 73 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-495 76 82 m8 hsa-miR-495brain AAACAAACAUGGUGCACUUCUUU