Gene Page:HIVEP3
Summary?
GeneID | 59269 |
Symbol | HIVEP3 |
Synonyms | KBP-1|KBP1|KRC|SHN3|Schnurri-3|ZAS3|ZNF40C |
Description | human immunodeficiency virus type I enhancer binding protein 3 |
Reference | MIM:606649|HGNC:HGNC:13561|Ensembl:ENSG00000127124|HPRD:09442|Vega:OTTHUMG00000006361 |
Gene type | protein-coding |
Map location | 1p34 |
Pascal p-value | 0.148 |
TADA p-value | 0.006 |
Fetal beta | -0.196 |
DMG | 1 (# studies) |
eGene | Cerebellar Hemisphere Cerebellum |
Support | CompositeSet Darnell FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 1 |
DNM:Fromer_2014 | Whole Exome Sequencing analysis | This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA. | |
Expression | Meta-analysis of gene expression | Pvalue: 1.807 |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
HIVEP3 | chr1 | 42047669 | G | A | NM_001127714 NM_024503 |
p.934Q>* p.934Q>* |
nonsense nonsense |
Schizophrenia | DNM:Fromer_2014 | ||
HIVEP3 | chr1 | 42049410 | T | C | NM_001127714 NM_024503 |
. . |
silent silent |
Schizophrenia | DNM:Fromer_2014 |
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg16685388 | 1 | 42384056 | HIVEP3 | -0.041 | 0.74 | DMG:Nishioka_2013 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/HIVEP3_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003677 | DNA binding | IEA | - | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0016563 | transcription activator activity | IDA | 15790681 | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0045941 | positive regulation of transcription | IDA | 15790681 | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005622 | intracellular | IEA | - | |
GO:0005634 | nucleus | IEA | - | |
GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
TURASHVILI BREAST DUCTAL CARCINOMA VS LOBULAR NORMAL DN | 69 | 43 | All SZGR 2.0 genes in this pathway |
THUM SYSTOLIC HEART FAILURE DN | 244 | 147 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN | 770 | 415 | All SZGR 2.0 genes in this pathway |
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
EBAUER TARGETS OF PAX3 FOXO1 FUSION UP | 207 | 128 | All SZGR 2.0 genes in this pathway |
HEIDENBLAD AMPLICON 8Q24 DN | 46 | 28 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
PASQUALUCCI LYMPHOMA BY GC STAGE UP | 283 | 177 | All SZGR 2.0 genes in this pathway |
LEE CALORIE RESTRICTION NEOCORTEX DN | 88 | 58 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
RIGGI EWING SARCOMA PROGENITOR UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
LEE INTRATHYMIC T PROGENITOR | 21 | 14 | All SZGR 2.0 genes in this pathway |
ASGHARZADEH NEUROBLASTOMA POOR SURVIVAL DN | 46 | 30 | All SZGR 2.0 genes in this pathway |
MARTENS BOUND BY PML RARA FUSION | 456 | 287 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
CHYLA CBFA2T3 TARGETS UP | 387 | 225 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 2 DN | 336 | 211 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D | 882 | 506 | All SZGR 2.0 genes in this pathway |
PLASARI TGFB1 TARGETS 10HR UP | 199 | 143 | All SZGR 2.0 genes in this pathway |
DELACROIX RAR BOUND ES | 462 | 273 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY LUMINAL PROGENITOR UP | 58 | 30 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124/506 | 160 | 166 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-217 | 148 | 154 | m8 | hsa-miR-217 | UACUGCAUCAGGAACUGAUUGGAU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.