Gene Page:UPF1

Summary?
GeneID 5976
Symbol UPF1
Synonyms HUPF1|NORF1|RENT1|pNORF1|smg-2
Description UPF1, RNA helicase and ATPase
Reference MIM:601430|HGNC:HGNC:9962|Ensembl:ENSG00000005007|HPRD:03254|Vega:OTTHUMG00000183025
Gene type protein-coding
Map location 19p13.11
Pascal p-value 0.556
Sherlock p-value 0.147
Fetal beta 0.29
Support Ascano FMRP targets

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 0.5939

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

没有大脑中的基因区域


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0000166 nucleotide binding IEA -
GO:0003677 DNA binding IEA -
GO:0003682 chromatin binding IDA 16488880
GO:0003723 RNA binding NAS 10999600
GO:0004004 ATP-dependent RNA helicase activity IDA 12554878
GO:0005515 protein binding 新闻学会 9620853|11544179
GO:0005524 ATP binding IEA -
GO:0004386 helicase activity NAS 9064659
GO:0016787 hydrolase activity IEA -
GO:0008270 zinc ion binding IEA -
GO:0046872 metal ion binding IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0000184 nuclear-transcribed mRNA catabolic process, nonsense-mediated decay NAS 10999600
GO:0006396 RNA processing TAS 8855285
GO:0006406 mRNA export from nucleus TAS 16488880
GO:0006449 regulation of translational termination IMP 9620853
GO:0006449 regulation of translational termination NAS 10999600
去:0006281 DNA repair IDA 16488880
GO:0006260 DNA replication IMP 16488880
GO:0007049 cell cycle IMP 16488880
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0000785 chromatin IDA 16488880
GO:0005737 cytoplasm NAS 9064659

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
ATM AT1 | ATA | ATC | ATD | ATDC | ATE | DKFZp781A0353 | MGC74674 | TEL1 | TELO1 ataxia telangiectasia mutated ATM phosphorylates hUpf1. BIND 15175154
DCP1A FLJ21691 | HSA275986 | Nbla00360 | SMAD4IP1 | SMIF DCP1 decapping enzyme homolog A (S. cerevisiae) Affinity Capture-Western BioGRID 12417715
DCP2 FLJ33245 | NUDT20 DCP2 decapping enzyme homolog (S. cerevisiae) - HPRD,BioGRID 12417715
EXOSC10 PM-Scl | PM/Scl-100 | PMSCL | PMSCL2 | RRP6 | Rrp6p | p2 | p3 | p4 exosome component 10 Affinity Capture-Western BioGRID 14527413
EXOSC2 RRP4 | Rrp4p | hRrp4p | p7 exosome component 2 Affinity Capture-Western BioGRID 14527413
EXOSC4 FLJ20591 | RRP41 | RRP41A | Rrp41p | SKI6 | Ski6p | hRrp41p | p12A exosome component 4 - HPRD,BioGRID 14527413
HIRA DGCR1 | TUP1 | TUPLE1 HIR histone cell cycle regulation defective homolog A (S. cerevisiae) - HPRD,BioGRID 15231747
LSM8 YJR022W LSM8 homolog, U6 small nuclear RNA associated (S. cerevisiae) - HPRD,BioGRID 15231747
PABPC1 PAB1 | PABP | PABP1 | PABPC2 | PABPL1 poly(A) binding protein, cytoplasmic 1 Affinity Capture-MS BioGRID 12723973
PARN DAN poly(A)-specific ribonuclease (deadenylation nuclease) Affinity Capture-Western BioGRID 14527413
POLR2A MGC75453 | POLR2 | POLRA | RPB1 | RPBh1 | RPO2 | RPOL2 | RpIILS | hRPB220 | hsRPB1 polymerase (RNA) II (DNA directed) polypeptide A, 220kDa - HPRD 6200476
SMG1 61E3.4 | ATX | KIAA0421 | LIP PI-3-kinase-related kinase SMG-1 - HPRD,BioGRID 11544179
SMG1 61E3.4 | ATX | KIAA0421 | LIP PI-3-kinase-related kinase SMG-1 hSMG-1 phosphorylates hUpf1. BIND 15175154
SMG5 EST1B | FLJ34864 | KIAA1089 | LPTS-RP1 | LPTSRP1 | RP11-54H19.7 | SMG-5 Smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans) - HPRD 14636577
SMG6 C17orf31 | EST1A | KIAA0732 | SMG-6 Smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans) UPF1 interacts with SMG6. BIND 15721257
SMG7 C1orf16 | EST1C | FLJ23717 | KIAA0250 | SGA56M | SMG-7 Smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans) SMG7与UPF1交互。 BIND 15721257
STAU1 FLJ25010 | STAU staufen, RNA binding protein, homolog 1 (Drosophila) Upf1 interacts with Stau1. BIND 15680326
UPF2 DKFZp434D222 | HUPF2 | KIAA1408 | MGC138834 | MGC138835 | RENT2 | smg-3 UPF2 regulator of nonsense transcripts homolog (yeast) Upf1 interacts with Upf2. BIND 15680326
UPF2 DKFZp434D222 | HUPF2 | KIAA1408 | MGC138834 | MGC138835 | RENT2 | smg-3 UPF2 regulator of nonsense transcripts homolog (yeast) - HPRD,BioGRID 11073994
UPF2 DKFZp434D222 | HUPF2 | KIAA1408 | MGC138834 | MGC138835 | RENT2 | smg-3 UPF2 regulator of nonsense transcripts homolog (yeast) - HPRD 11073994|12723973
UPF3A HUPF3A | RENT3A | UPF3 UPF3 regulator of nonsense transcripts homolog A (yeast) - HPRD,BioGRID 11163187
UPF3B HUPF3B | MRXS14 | RENT3B | UPF3X UPF3 regulator of nonsense transcripts homolog B (yeast) Upf1 interacts with Upf3X. BIND 15680326
UPF3B HUPF3B | MRXS14 | RENT3B | UPF3X UPF3 regulator of nonsense transcripts homolog B (yeast) - HPRD,BioGRID 12723973
XRN1 DKFZp434P0721 | DKFZp686B22225 | DKFZp686F19113 | FLJ41903 | SEP1 5'-3' exoribonuclease 1 - HPRD,BioGRID 14527413


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
PARENT MTOR SIGNALING UP 567 375 All SZGR 2.0 genes in this pathway
FRASOR TAMOXIFEN RESPONSE UP 51 36 All SZGR 2.0 genes in this pathway
GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN 493 298 All SZGR 2.0 genes in this pathway
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN 663 425 All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP 1382 904 All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 1 UP 380 236 All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 UP 418 263 All SZGR 2.0 genes in this pathway
UDAYAKUMAR MED1 TARGETS DN 240 171 All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS 957 597 All SZGR 2.0 genes in this pathway
MATSUDA NATURAL KILLER DIFFERENTIATION 475 313 All SZGR 2.0 genes in this pathway
THEILGAARD NEUTROPHIL AT SKIN WOUND DN 225 163 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 1691 1088 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 14HR UP 156 101 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 18HR UP 178 111 All SZGR 2.0 genes in this pathway
BANDRES RESPONSE TO CARMUSTIN MGMT 48HR DN 161 105 All SZGR 2.0 genes in this pathway
CAMPS COLON CANCER COPY NUMBER UP 92 45 All SZGR 2.0 genes in this pathway
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING 510 309 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-128 114 120 m8 hsa-miR-128a UCACAGUGAACCGGUCUCUUUU
hsa-miR-128b UCACAGUGAACCGGUCUCUUUC
miR-186 567 573 m8 hsa-miR-186 CAAAGAAUUCUCCUUUUGGGCUU
miR-370 371 377 1A hsa-miR-370brain GCCUGCUGGGGUGGAACCUGG