Gene Page:BRD2

Summary?
GeneID 6046
Symbol BRD2
Synonyms D6S113E|FSH|FSRG1|NAT|O27.1.1|RING3|RNF3
Description bromodomain containing 2
Reference MIM:601540|HGNC:HGNC:1103|Ensembl:ENSG00000204256|HPRD:03326|Vega:OTTHUMG00000031241
Gene type protein-coding
Map location 6p21.3
Pascal p-value 7.957E-11
Sherlock p-value 0.708
Fetal beta 0.661
DMG 1 (# studies)
eGene Frontal Cortex BA9

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 2
GSMA_I Genome scan meta-analysis Psr: 0.033

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg20222521 6 32937347 BRD2 7.27E-10 -0.011 9.91E-7 DMG:Jaffe_2016
cg01652681 6 32937649 BRD2 6.48E-9 -0.014 3.37E-6 DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconceptionweeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0004674 protein serine/threonine kinase activity TAS 9693039
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007283 spermatogenesis TAS 9693039
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005634 nucleus IEA -
GO:0005737 cytoplasm IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
PID RB 1PATHWAY 65 46 All SZGR 2.0 genes in this pathway
GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN 493 298 All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER 20Q13 AMPLIFICATION DN 180 101 All SZGR 2.0 genes in this pathway
UDAYAKUMAR MED1 TARGETS DN 240 171 All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE UP 530 342 All SZGR 2.0 genes in this pathway
APPIERTO RESPONSE TO FENRETINIDE UP 38 26 All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE UP 134 93 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 UP 309 199 All SZGR 2.0 genes in this pathway
DIERICK SEROTONIN FUNCTION GENES 6 6 All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP 811 508 All SZGR 2.0 genes in this pathway
AMIT EGF RESPONSE 480 HELA 164 118 All SZGR 2.0 genes in this pathway
ASTON MAJOR DEPRESSIVE DISORDER DN 160 110 All SZGR 2.0 genes in this pathway
PENG LEUCINE DEPRIVATION DN 187 122 All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS 882 572 All SZGR 2.0 genes in this pathway
REN BOUND BY E2F 61 40 All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR DN 25 15 All SZGR 2.0 genes in this pathway
LEI MYB TARGETS 318 215 All SZGR 2.0 genes in this pathway
LENAOUR DENDRITIC CELL MATURATION DN 128 90 All SZGR 2.0 genes in this pathway
NGUYEN NOTCH1 TARGETS DN 86 67 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 20HR UP 240 152 All SZGR 2.0 genes in this pathway
DAZARD UV RESPONSE CLUSTER G3 15 10 All SZGR 2.0 genes in this pathway
LU AGING BRAIN DN 153 120 All SZGR 2.0 genes in this pathway
KAYO AGING MUSCLE UP 244 165 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 1691 1088 All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK UP 244 151 All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C0 107 72 All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C3 20 15 All SZGR 2.0 genes in this pathway
WELCSH BRCA1 TARGETS DN 141 92 All SZGR 2.0 genes in this pathway
MONNIER POSTRADIATION TUMOR ESCAPE UP 393 244 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON UP 77 47 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP 673 430 All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN 593 372 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN 591 366 All SZGR 2.0 genes in this pathway
MITSIADES RESPONSE TO APLIDIN UP 439 257 All SZGR 2.0 genes in this pathway
WANG TUMOR INVASIVENESS UP 374 247 All SZGR 2.0 genes in this pathway
LEE DIFFERENTIATING T LYMPHOCYTE 200 115 All SZGR 2.0 genes in this pathway
HSIAO HOUSEKEEPING GENES 389 245 All SZGR 2.0 genes in this pathway
DANG REGULATED BY MYC DN 253 192 All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 7 76 46 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 4HR UP 55 41 All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS CALB1 CORR UP 548 370 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 DN 918 550 All SZGR 2.0 genes in this pathway
YUAN ZNF143 PARTNERS 22 15 All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3 824 528 All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D 658 397 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-143 96 103 1A,m8 hsa-miR-143brain UGAGAUGAAGCACUGUAGCUCA
miR-21 367 373 1A hsa-miR-21brain UAGCUUAUCAGACUGAUGUUGA
hsa-miR-590 GAGCUUAUUCAUAAAAGUGCAG