Gene Page:ROCK1
Summary?
GeneID | 6093 |
Symbol | ROCK1 |
Synonyms | P160ROCK|ROCK-I |
Description | Rho associated coiled-coil containing protein kinase 1 |
Reference | MIM:601702|HGNC:HGNC:10251|Ensembl:ENSG00000067900|HPRD:03414|Vega:OTTHUMG00000131723 |
Gene type | protein-coding |
Map location | 18q11.1 |
Pascal p-value | 0.916 |
Fetal beta | 1.738 |
DMG | 1 (# studies) |
eGene | Cortex Myers' cis & trans |
Support | INTRACELLULAR SIGNAL TRANSDUCTION |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
PMID:cooccur | High-throughput literature-search | 系统搜索PubMed的genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0021 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg23360087 | 18 | 18691952 | ROCK1 | 1.48E-5 | -0.726 | 0.015 | DMG:Wockner_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs1507047 | chr16 | 50932778 | ROCK1 | 6093 | 0.06 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC:分皮质区域;SM:感觉-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
RPS8 | 0.97 | 0.94 |
BTF3 | 0.97 | 0.94 |
RPL4 | 0.96 | 0.94 |
RPS6 | 0.96 | 0.95 |
NACA | 0.95 | 0.94 |
TUT1 | 0.95 | 0.91 |
RPL10A | 0.95 | 0.97 |
IGBP1 | 0.94 | 0.89 |
RPL6P10 | 0.94 | 0.93 |
RPS3P3 | 0.94 | 0.93 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
FBXO2 | -0.67 | -0.71 |
HLA-F | -0.67 | -0.74 |
ATP10A | -0.67 | -0.79 |
AIFM3 | -0.65 | -0.72 |
ARHGAP22 | -0.64 | -0.71 |
APOL1 | -0.64 | -0.79 |
SLC6A12 | -0.63 | -0.79 |
TINAGL1 | -0.63 | -0.77 |
APOL3 | -0.63 | -0.79 |
LDHD | -0.63 | -0.69 |
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0005524 | ATP binding | IEA | - | |
GO:0004674 | protein serine/threonine kinase activity | TAS | 8798490 | |
GO:0016740 | transferase activity | IEA | - | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0042802 | identical protein binding | 新闻学会 | 16249185 | |
GO:0019992 | diacylglycerol binding | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0043524 | negative regulation of neuron apoptosis | IEA | neuron (GO term level: 9) | - |
GO:0000910 | cytokinesis | IEA | - | |
GO:0022614 | membrane to membrane docking | IDA | 12082081 | |
GO:0006468 | protein amino acid phosphorylation | TAS | 10436159 | |
GO:0007266 | Rho protein signal transduction | TAS | 8798490 | |
GO:0007242 | intracellular signaling cascade | IEA | - | |
GO:0006915 | apoptosis | IEA | - | |
GO:0030036 | actin cytoskeleton organization | TAS | 10436159 | |
GO:0050901 | leukocyte tethering or rolling | IDA | 12082081 | |
GO:0050900 | leukocyte migration | IDA | 12082081 | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0000139 | Golgi membrane | IEA | - | |
GO:0005794 | Golgi apparatus | IEA | - | |
GO:0005829 | cytosol | EXP | 16983089 | |
GO:0005622 | intracellular | IEA | - | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0016020 | membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG CHEMOKINE SIGNALING PATHWAY | 190 | 128 | All SZGR 2.0 genes in this pathway |
KEGG VASCULAR SMOOTH MUSCLE CONTRACTION | 115 | 81 | All SZGR 2.0 genes in this pathway |
KEGG WNT SIGNALING PATHWAY | 151 | 112 | All SZGR 2.0 genes in this pathway |
KEGG TGF BETA SIGNALING PATHWAY | 86 | 64 | All SZGR 2.0 genes in this pathway |
KEGG AXON GUIDANCE | 129 | 103 | All SZGR 2.0 genes in this pathway |
KEGG FOCAL ADHESION | 201 | 138 | All SZGR 2.0 genes in this pathway |
KEGG LEUKOCYTE TRANSENDOTHELIAL MIGRATION | 118 | 78 | All SZGR 2.0 genes in this pathway |
KEGG REGULATION OF ACTIN CYTOSKELETON | 216 | 144 | All SZGR 2.0 genes in this pathway |
KEGG PATHOGENIC ESCHERICHIA COLI INFECTION | 59 | 36 | All SZGR 2.0 genes in this pathway |
BIOCARTA ECM PATHWAY | 24 | 17 | All SZGR 2.0 genes in this pathway |
BIOCARTA INTEGRIN PATHWAY | 38 | 29 | All SZGR 2.0 genes in this pathway |
BIOCARTA MYOSIN PATHWAY | 31 | 22 | All SZGR 2.0 genes in this pathway |
BIOCARTA RHO PATHWAY | 32 | 23 | All SZGR 2.0 genes in this pathway |
BIOCARTA MAL PATHWAY | 19 | 17 | All SZGR 2.0 genes in this pathway |
BIOCARTA PAR1 PATHWAY | 37 | 28 | All SZGR 2.0 genes in this pathway |
SIG CHEMOTAXIS | 45 | 37 | All SZGR 2.0 genes in this pathway |
SIG REGULATION OF THE ACTIN CYTOSKELETON BY RHO GTPASES | 35 | 25 | All SZGR 2.0 genes in this pathway |
ST INTEGRIN SIGNALING PATHWAY | 82 | 62 | All SZGR 2.0 genes in this pathway |
ST GA13 PATHWAY | 37 | 32 | All SZGR 2.0 genes in this pathway |
ST FAS SIGNALING PATHWAY | 65 | 54 | All SZGR 2.0 genes in this pathway |
PID PRL SIGNALING EVENTS PATHWAY | 23 | 17 | All SZGR 2.0 genes in this pathway |
PID RHOA PATHWAY | 45 | 33 | All SZGR 2.0 genes in this pathway |
PID WNT NONCANONICAL PATHWAY | 32 | 26 | All SZGR 2.0 genes in this pathway |
PID EPHB FWD PATHWAY | 40 | 38 | All SZGR 2.0 genes in this pathway |
PID TXA2PATHWAY | 57 | 43 | All SZGR 2.0 genes in this pathway |
PID THROMBIN PAR4 PATHWAY | 15 | 11 | All SZGR 2.0 genes in this pathway |
PID AMB2 NEUTROPHILS PATHWAY | 41 | 32 | All SZGR 2.0 genes in this pathway |
PID AVB3 INTEGRIN PATHWAY | 75 | 53 | All SZGR 2.0 genes in this pathway |
PID EPHA FWDPATHWAY | 34 | 29 | All SZGR 2.0 genes in this pathway |
PID ECADHERIN STABILIZATION PATHWAY | 42 | 34 | All SZGR 2.0 genes in this pathway |
PID VEGFR1 2 PATHWAY | 69 | 57 | All SZGR 2.0 genes in this pathway |
PID THROMBIN PAR1 PATHWAY | 43 | 32 | All SZGR 2.0 genes in this pathway |
PID NCADHERIN PATHWAY | 33 | 32 | All SZGR 2.0 genes in this pathway |
REACTOME APOPTOTIC CLEAVAGE OF CELLULAR PROTEINS | 40 | 26 | All SZGR 2.0 genes in this pathway |
REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
REACTOME G ALPHA1213 SIGNALLING EVENTS | 74 | 56 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR DOWNSTREAM SIGNALING | 805 | 368 | All SZGR 2.0 genes in this pathway |
REACTOME SEMA4D IN SEMAPHORIN SIGNALING | 32 | 22 | All SZGR 2.0 genes in this pathway |
REACTOME SEMAPHORIN INTERACTIONS | 68 | 53 | All SZGR 2.0 genes in this pathway |
REACTOME SEMA4D INDUCED CELL MIGRATION AND GROWTH CONE COLLAPSE | 27 | 21 | All SZGR 2.0 genes in this pathway |
REACTOME APOPTOSIS | 148 | 94 | All SZGR 2.0 genes in this pathway |
REACTOME APOPTOTIC EXECUTION PHASE | 54 | 37 | All SZGR 2.0 genes in this pathway |
BERENJENO ROCK SIGNALING NOT VIA RHOA DN | 48 | 34 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
SIMBULAN UV RESPONSE IMMORTALIZED DN | 31 | 26 | All SZGR 2.0 genes in this pathway |
TSAI RESPONSE TO IONIZING RADIATION | 149 | 101 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
GOTZMANN EPITHELIAL TO MESENCHYMAL TRANSITION DN | 206 | 136 | All SZGR 2.0 genes in this pathway |
BENPORATH CYCLING GENES | 648 | 385 | All SZGR 2.0 genes in this pathway |
STARK PREFRONTAL CORTEX 22Q11 DELETION UP | 195 | 138 | All SZGR 2.0 genes in this pathway |
SHEN SMARCA2 TARGETS UP | 424 | 268 | All SZGR 2.0 genes in this pathway |
GOLDRATH HOMEOSTATIC PROLIFERATION | 171 | 102 | All SZGR 2.0 genes in this pathway |
LEE LIVER CANCER MYC E2F1 UP | 56 | 34 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
PENG RAPAMYCIN RESPONSE UP | 203 | 130 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP | 555 | 346 | All SZGR 2.0 genes in this pathway |
THEILGAARD NEUTROPHIL AT SKIN WOUND DN | 225 | 163 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
BURTON ADIPOGENESIS 12 | 36 | 18 | All SZGR 2.0 genes in this pathway |
CHIBA RESPONSE TO TSA DN | 23 | 14 | All SZGR 2.0 genes in this pathway |
RIZKI TUMOR INVASIVENESS 3D DN | 270 | 181 | All SZGR 2.0 genes in this pathway |
ZHANG TLX TARGETS 36HR DN | 185 | 116 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS UP | 518 | 299 | All SZGR 2.0 genes in this pathway |
DANG REGULATED BY MYC DN | 253 | 192 | All SZGR 2.0 genes in this pathway |
MURAKAMI UV RESPONSE 1HR DN | 10 | 8 | All SZGR 2.0 genes in this pathway |
FEVR CTNNB1 TARGETS DN | 553 | 343 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION UP | 570 | 339 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124.1 | 931 | 938 | 1A,m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-124/506 | 930 | 937 | 1A,m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-135 | 699 | 706 | 1A,m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
miR-139 | 538 | 545 | 1A,m8 | hsa-miR-139brain | UCUACAGUGCACGUGUCU |
miR-145 | 1357 | 1363 | 1A | hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU |
miR-148/152 | 1414 | 1420 | 1A | hsa-miR-148a | UCAGUGCACUACAGAACUUUGU |
hsa-miR-152brain | UCAGUGCAUGACAGAACUUGGG | ||||
hsa-miR-148b | UCAGUGCAUCACAGAACUUUGU | ||||
hsa-miR-148a | UCAGUGCACUACAGAACUUUGU | ||||
hsa-miR-152brain | UCAGUGCAUGACAGAACUUGGG | ||||
hsa-miR-148b | UCAGUGCAUCACAGAACUUUGU | ||||
miR-150 | 653 | 659 | 1A | hsa-miR-150 | UCUCCCAACCCUUGUACCAGUG |
miR-153 | 684 | 690 | m8 | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
miR-182 | 694 | 700 | m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-190 | 1438 | 1444 | m8 | hsa-miR-190 | UGAUAUGUUUGAUAUAUUAGGU |
miR-199 | 1356 | 1362 | 1A | hsa-miR-199a | CCCAGUGUUCAGACUACCUGUUC |
hsa-miR-199b | CCCAGUGUUUAGACUAUCUGUUC | ||||
miR-217 | 1330 | 1336 | 1A | hsa-miR-217 | UACUGCAUCAGGAACUGAUUGGAU |
miR-323 | 1335 | 1341 | m8 | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
miR-33 | 218 | 224 | 1A | hsa-miR-33 | GUGCAUUGUAGUUGCAUUG |
hsa-miR-33b | GUGCAUUGCUGUUGCAUUGCA | ||||
miR-335 | 472 | 478 | m8 | hsa-miR-335brain | UCAAGAGCAAUAACGAAAAAUGU |
miR-34/449 | 956 | 962 | 1A | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
miR-493-5p | 745 | 751 | 1A | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
miR-494 | 631 | 638 | 1A,m8 | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU |
hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU | ||||
miR-496 | 880 | 886 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
miR-539 | 1535 | 1541 | 1A | hsa-miR-539 | GGAGAAAUUAUCCUUGGUGUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.