Gene Page:RTN1
Summary?
GeneID | 6252 |
Symbol | RTN1 |
Synonyms | NSP |
Description | reticulon 1 |
Reference | MIM:600865|HGNC: HGNC: 10467|Ensembl:ENSG00000139970|HPRD:02921|Vega:OTTHUMG00000028947 |
Gene type | protein-coding |
Map location | 14q23.1 |
Pascal p-value | 7.069E-6 |
Sherlock p-value | 0.957 |
Fetal beta | 0.806 |
DMG | 1 (# studies) |
Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.human_clathrin G2Cdb.human_Synaptosome G2Cdb.humanNRC CompositeSet Darnell FMRP targets Potential synaptic genes |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg20246273 | 14 | 60192278 | RTN1 | 3.16E-4 | 0.398 | 0.04 | DMG:Wockner_2014 |
cg04346701 | 14 | 60096225 | RTN1 | 4.39E-4 | 0.491 | 0.045 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/RTN1_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
S100A13 | 0.85 | 0.93 |
FXYD1 | 0.84 | 0.92 |
AC021016.1 | 0.84 | 0.92 |
PSMB9 | 0.83 | 0.91 |
S100A1 | 0.82 | 0.90 |
BDH2 | 0.80 | 0.86 |
COPZ2 | 0.80 | 0.85 |
ROM1 | 0.80 | 0.88 |
TSC22D4 | 0.80 | 0.88 |
SERPINB6 | 0.80 | 0.88 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
LSM14B | -0.79 | -0.87 |
PJA1 | -0.79 | -0.85 |
LASP1 | -0.79 | -0.86 |
RNASEN | -0.79 | -0.86 |
PRCC | -0.78 | -0.86 |
RAB35 | -0.78 | -0.85 |
PSPC1 | -0.78 | -0.84 |
FAM40A | -0.78 | -0.86 |
HEATR5B | -0.78 | -0.83 |
RNF40 | -0.78 | -0.84 |
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
: 0004871 | signal transducer activity | NAS | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0030182 | neuron differentiation | TAS | neuron (GO term level: 8) | - |
GO:0007165 | signal transduction | NAS | - | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005789 | endoplasmic reticulum membrane | IEA | - | |
GO:0005783 | endoplasmic reticulum | IEA | - | |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - | |
GO:0030176 | integral to endoplasmic reticulum membrane | TAS | 8833145 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PARENT MTOR SIGNALING UP | 567 | 375 | All SZGR 2.0 genes in this pathway |
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP | 579 | 346 | All SZGR 2.0 genes in this pathway |
DOANE RESPONSE TO ANDROGEN DN | 241 | 146 | All SZGR 2.0 genes in this pathway |
武田的目标NUP98 HOXA9融合3 d | 182 | 110 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 10D DN | 142 | 90 | All SZGR 2.0 genes in this pathway |
SABATES COLORECTAL ADENOMA DN | 291 | 176 | All SZGR 2.0 genes in this pathway |
JAATINEN HEMATOPOIETIC STEM CELL DN | 226 | 132 | All SZGR 2.0 genes in this pathway |
CONCANNON APOPTOSIS BY EPOXOMICIN DN | 172 | 112 | All SZGR 2.0 genes in this pathway |
FARMER BREAST CANCER APOCRINE VS LUMINAL | 326 | 213 | All SZGR 2.0 genes in this pathway |
MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN | 164 | 111 | All SZGR 2.0 genes in this pathway |
HASINA NOL7 TARGETS UP | 13 | 11 | All SZGR 2.0 genes in this pathway |
ROZANOV MMP14 TARGETS DN | 35 | 22 | All SZGR 2.0 genes in this pathway |
LE EGR2 TARGETS DN | 108 | 84 | All SZGR 2.0 genes in this pathway |
POMEROY MEDULLOBLASTOMA PROGNOSIS UP | 47 | 30 | All SZGR 2.0 genes in this pathway |
GUO HEX TARGETS UP | 81 | 54 | All SZGR 2.0 genes in this pathway |
LENAOUR DENDRITIC CELL MATURATION DN | 128 | 90 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
KAYO AGING MUSCLE UP | 244 | 165 | All SZGR 2.0 genes in this pathway |
RODWELL AGING KIDNEY UP | 487 | 303 | All SZGR 2.0 genes in this pathway |
WANG SMARCE1 TARGETS UP | 280 | 183 | All SZGR 2.0 genes in this pathway |
LEIN NEURON MARKERS | 69 | 45 | All SZGR 2.0 genes in this pathway |
WALLACE PROSTATE CANCER RACE DN | 88 | 42 | All SZGR 2.0 genes in this pathway |
HANN RESISTANCE TO BCL2 INHIBITOR UP | 36 | 24 | All SZGR 2.0 genes in this pathway |
TING SILENCED BY DICER | 31 | 17 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER LUMINAL A UP | 84 | 52 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
ZHENG IL22 SIGNALING UP | 56 | 36 | All SZGR 2.0 genes in this pathway |
LINDSTEDT DENDRITIC CELL MATURATION A | 67 | 52 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
RAO BOUND BY SALL4 ISOFORM B | 517 | 302 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-130/301 | 712 | 718 | m8 | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
miR-142-5p | 646 | 652 | m8 | hsa-miR-142-5p | CAUAAAGUAGAAAGCACUAC |
miR-19 | 711 | 717 | m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
miR-26 | 723 | 729 | m8 | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
miR-381 | 526 | 532 | 1A | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
miR-93.hd/291-3p/294/295/302/372/373/520 | 714 | 720 | 1A | hsa-miR-93brain | AAAGUGCUGUUCGUGCAGGUAG |
hsa-miR-302a | UAAGUGCUUCCAUGUUUUGGUGA | ||||
hsa-miR-302b | UAAGUGCUUCCAUGUUUUAGUAG | ||||
hsa-miR-302c | UAAGUGCUUCCAUGUUUCAGUGG | ||||
hsa-miR-302d | UAAGUGCUUCCAUGUUUGAGUGU | ||||
hsa-miR-372 | AAAGUGCUGCGACAUUUGAGCGU | ||||
hsa-miR-373 | GAAGUGCUUCGAUUUUGGGGUGU | ||||
hsa-miR-520e | AAAGUGCUUCCUUUUUGAGGG | ||||
hsa-miR-520a | AAAGUGCUUCCCUUUGGACUGU | ||||
hsa-miR-520b | AAAGUGCUUCCUUUUAGAGGG | ||||
hsa-miR-520c | AAAGUGCUUCCUUUUAGAGGGUU | ||||
hsa-miR-520d | AAAGUGCUUCUCUUUGGUGGGUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.