Gene Page:RYR2

Summary?
GeneID 6262
Symbol RYR2
Synonyms ARVC2|ARVD2|RYR-2|RyR|VTSIP
Description ryanodine receptor 2
Reference MIM:180902|HGNC:HGNC:10484|Ensembl:ENSG00000198626|HPRD:01619|Vega:OTTHUMG00000039543
Gene type protein-coding
Map location 1q43
Fetal beta -2.238
eGene Meta
Support INTRACELLULAR SIGNAL TRANSDUCTION
G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS
G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL
G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS
G2Cdb.humanPSD
G2Cdb.humanPSP
CompositeSet
Darnell FMRP targets
Ascano FMRP targets

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search 系统搜索PubMed co-o基因ccurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 0.0397

Section I. Genetics and epigenetics annotation

@DNM table

Gene Chromosome Position Ref Alt Transcript AA change Mutation type Sift CG46 Trait Study
RYR2 chr1 237919662 G A NM_001035 . silent Schizophrenia DNM:Fromer_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AC087071.1 0.73 0.44
AL353354.3 0.70 0.41
FAM159B 0.68 0.46
SPDYA 0.66 0.49
C17orf84 0.65 0.17
AC120053.1 0.64 0.49
AL050337.1 0.63 0.34
PIGB 0.62 0.39
NOX1 0.62 0.42
C1orf61 0.61 0.34
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
FAM82A2 -0.49 -0.32
OGDH -0.49 -0.40
EPN2 -0.47 -0.40
CNDP2 -0.47 -0.36
MYH9 -0.47 -0.45
LARS2 -0.46 -0.30
RHOB -0.46 -0.31
HSPA9 -0.46 -0.33
AGPAT3 -0.46 -0.40
EPM2A -0.45 -0.33

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0004872 receptor activity IEA -
GO:0005509 calcium ion binding IEA -
GO:0005516 calmodulin binding IEA -
GO:0005216 ion channel activity IEA -
GO:0005219 ryanodine-sensitive calcium-release channel activity IEA -
GO:0015278 calcium-release channel activity TAS 10830164
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0008627 induction of apoptosis by ionic changes IDA 15044459
GO:0007165 signal transduction NAS 10463072
GO:0008016 regulation of heart contraction TAS 10830164
GO:0006816 calcium ion transport IEA -
GO:0006811 ion transport IEA -
GO:0006936 muscle contraction TAS 10830164
GO:0006874 cellular calcium ion homeostasis IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0016021 integral to membrane IEA -
GO:0005886 plasma membrane TAS 10830164

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
AKAP6 ADAP100 | ADAP6 | AKAP100 | KIAA0311 | MGC165020 | PRKA6 | mAKAP A kinase (PRKA) anchor protein 6 - HPRD,BioGRID 11352932
CACNA1C CACH2 | CACN2 | CACNL1A1 | CCHL1A1 | CaV1.2 | MGC120730 | TS calcium channel, voltage-dependent, L type, alpha 1C subunit - HPRD,BioGRID 11576544
FKBP1B FKBP12.6 | FKBP1L | OTK4 | PKBP1L | PPIase FK506 binding protein 1B, 12.6 kDa - HPRD,BioGRID 10830164|12443530
|12446682
HOMER1 HOMER | HOMER1A | HOMER1B | HOMER1C | SYN47 | Ves-1 homer homolog 1 (Drosophila) - HPRD,BioGRID 12887973
PPP1CA MGC15877 | MGC1674 | PP-1A | PPP1A protein phosphatase 1, catalytic subunit, alpha isoform Co-fractionation BioGRID 10830164
PPP1CB MGC3672 | PP-1B | PPP1CD protein phosphatase 1, catalytic subunit, beta isoform Co-fractionation BioGRID 10830164
PPP1CC PPP1G protein phosphatase 1, catalytic subunit, gamma isoform Co-fractionation BioGRID 10830164
PRKACA MGC102831 | MGC48865 | PKACA protein kinase, cAMP-dependent, catalytic, alpha Biochemical Activity
Co-fractionation		 BioGRID 10830164
PRKACB DKFZp781I2452 | MGC41879 | MGC9320 | PKACB protein kinase, cAMP-dependent, catalytic, beta Biochemical Activity
Co-fractionation		 BioGRID 10830164
PRKACG KAPG | PKACg protein kinase, cAMP-dependent, catalytic, gamma Biochemical Activity
Co-fractionation		 BioGRID 10830164
PRKAR2A MGC3606 | PKR2 | PRKAR2 蛋白激酶,cAMP-dependent、监管、类型I, alpha - HPRD,BioGRID 10830164
PRKAR2B PRKAR2 | RII-BETA 蛋白激酶,cAMP-dependent、监管、类型I, beta Co-fractionation BioGRID 10830164
RYR1 CCO | MHS | MHS1 | RYDR | RYR | SKRR ryanodine receptor 1 (skeletal) - HPRD,BioGRID 12213830
RYR2 ARVC2 | ARVD2 | VTSIP ryanodine receptor 2 (cardiac) Co-fractionation BioGRID 10830164
RYR3 - ryanodine receptor 3 - HPRD,BioGRID 12213830
SRI FLJ26259 | SCN sorcin - HPRD,BioGRID 7592856


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG CALCIUM SIGNALING PATHWAY 178 134 All SZGR 2.0 genes in this pathway
KEGG CARDIAC MUSCLE CONTRACTION 80 51 All SZGR 2.0 genes in this pathway
KEGG HYPERTROPHIC CARDIOMYOPATHY HCM 85 65 All SZGR 2.0 genes in this pathway
KEGG ARRHYTHMOGENIC RIGHT VENTRICULAR CARDIOMYOPATHY ARVC 76 59 All SZGR 2.0 genes in this pathway
KEGG DILATED CARDIOMYOPATHY 92 68 All SZGR 2.0 genes in this pathway
BIOCARTA NO1 PATHWAY 33 24 All SZGR 2.0 genes in this pathway
PIEPOLI LGI1 TARGETS UP 15 11 All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER DN 232 154 All SZGR 2.0 genes in this pathway
MODY HIPPOCAMPUS POSTNATAL 63 50 All SZGR 2.0 genes in this pathway
LEIN NEURON MARKERS 69 45 All SZGR 2.0 genes in this pathway
YAUCH HEDGEHOG SIGNALING PARACRINE DN 264 159 All SZGR 2.0 genes in this pathway
VANASSE BCL2 TARGETS UP 40 25 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 349 234 All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE 721 492 All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K27ME3 341 243 All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3 590 403 All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS CALB1 CORR UP 548 370 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-124.1 463 469 m8 hsa-miR-124a UUAAGGCACGCGGUGAAUGCCA
miR-124/506 462 469 1A,m8 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brain UAAGGCACGCGGUGAAUGCC
miR-129-5p 810 817 1A,m8 hsa-miR-129brain CUUUUUGCGGUCUGGGCUUGC
hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGCU
miR-137 1107 1114 1A,m8 hsa-miR-137 UAUUGCUUAAGAAUACGCGUAG
miR-153 486 492 m8 hsa-miR-153 UUGCAUAGUCACAAAAGUGA
hsa-miR-153 UUGCAUAGUCACAAAAGUGA
miR-204/211 452 458 1A hsa-miR-204brain UUCCCUUUGUCAUCCUAUGCCU
hsa-miR-211 UUCCCUUUGUCAUCCUUCGCCU
miR-221/222 415 421 1A hsa-miR-221brain AGCUACAUUGUCUGCUGGGUUUC
hsa-miR-222brain AGCUACAUCUGGCUACUGGGUCUC
miR-375 869 875 1A hsa-miR-375 UUUGUUCGUUCGGCUCGCGUGA
miR-448 854 860 1A hsa-miR-448 UUGCAUAUGUAGGAUGUCCCAU
miR-450 810 816 1A hsa-miR-450 UUUUUGCGAUGUGUUCCUAAUA
miR-485-3p 790 797 1A,m8 hsa-miR-485-3p GUCAUACACGGCUCUCCUCUCU
miR-544 489 495 m8 hsa-miR-544 AUUCUGCAUUUUUAGCAAGU