Gene Page:BCORL1

Summary?
GeneID 63035
Symbol BCORL1
Synonyms BCoR-L1|CXorf10
Description BCL6 corepressor-like 1
Reference MIM:300688|HGNC:HGNC:25657|Ensembl:ENSG00000085185|HPRD:06517|Vega:OTTHUMG00000022379
Gene type protein-coding
Map location Xq25-q26.1
Sherlock p-value 0.092
Fetal beta 1.042
eGene Myers' cis & trans
Support CompositeSet

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DNM:Xu_2012 Whole Exome Sequencing analysis De novo mutations of 4 genes were identified by exome sequencing of 795 samples in this study
Expression Meta-analysis of gene expression Pvalue: 1.914

Section I. Genetics and epigenetics annotation

@DNM table

Gene Chromosome Position Ref Alt Transcript AA change Mutation type Sift CG46 Trait Study
BCORL1 chrX 129147913 A T NM_021946 p.389I F > missense Schizophrenia DNM:Xu_2012

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs16829545 chr2 151977407 BCORL1 63035 0.15 trans
rs7584986 chr2 184111432 BCORL1 63035 0.09 trans
rs3779491 chr7 95120635 BCORL1 63035 0.09 trans
rs16955618 chr15 29937543 BCORL1 63035 0.01 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Biological process GO term Evidence Neuro keywords PubMed ID
GO:0006355 regulation of transcription, DNA-dependent IEA -
GO:0006350 transcription IEA -
GO:0016568 chromatin modification IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005634 nucleus IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
DEURIG T细胞PROLYMPHOCYTIC白血病 368 234 All SZGR 2.0 genes in this pathway
ODONNELL METASTASIS UP 82 58 All SZGR 2.0 genes in this pathway
LIAO METASTASIS 539 324 All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215 893 528 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 491 319 All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D 658 397 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY 1725 838 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-128 495 502 1A,m8 hsa-miR-128a UCACAGUGAACCGGUCUCUUUU
hsa-miR-128b UCACAGUGAACCGGUCUCUUUC
miR-133 107 113 1A hsa-miR-133a UUGGUCCCCUUCAACCAGCUGU
hsa-miR-133b UUGGUCCCCUUCAACCAGCUA
miR-143 184 190 m8 hsa-miR-143brain UGAGAUGAAGCACUGUAGCUCA
miR-146 179 186 1A,m8 hsa-miR-146a UGAGAACUGAAUUCCAUGGGUU
hsa-miR-146bbrain UGAGAACUGAAUUCCAUAGGCU
miR-155 137 143 m8 hsa-miR-155 UUAAUGCUAAUCGUGAUAGGGG
miR-27 496 502 m8 hsa-miR-27abrain UUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrain UUCACAGUGGCUAAGUUCUGC
miR-29 715 721 m8 hsa-miR-29aSZ UAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZ UAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZ UAGCACCAUUUGAAAUCGGU
hsa-miR-29aSZ UAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZ UAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZ UAGCACCAUUUGAAAUCGGU
miR-382 512 518 m8 hsa-miR-382brain GAAGUUGUUCGUGGUGGAUUCG
miR-423 72 79 1A,m8 hsa-miR-423 AGCUCGGUCUGAGGCCCCUCAG
miR-486 1452 1458 m8 hsa-miR-486 UCCUGUACUGAGCUGCCCCGAG
miR-544 86 92 m8 hsa-miR-544 AUUCUGCAUUUUUAGCAAGU