Gene Page:SCN9A

Summary?
GeneID 6335
Symbol SCN9A
Synonyms ETHA|FEB3B|GEFSP7|HSAN2D|NE-NA|NENA|Nav1.7|PN1|SFNP
Description sodium voltage-gated channel alpha subunit 9
Reference MIM:603415|HGNC:HGNC:10597|Ensembl:ENSG00000169432|HPRD:04565|Vega:OTTHUMG00000154044
Gene type protein-coding
Map location 2q24
Pascal p-value 8.165E-4
eGene Cortex
Myers' cis & trans
Support EXCITABILITY

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.02395

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs17029291 chr3 32402138 SCN9A 6335 0.06 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
LY6G5B 0.68 0.61
ZNF789 0.68 0.64
CYP2R1 0.67 0.66
PBX4 0.67 0.67
DONSON 0.67 0.64
ZNF311 0.67 0.67
FBN3 0.65 0.69
RANBP17 0.65 0.61
ZNF337 0.65 0.62
HPX 0.65 0.52
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
FBXO2 -0.53 -0.61
HLA-F -0.51 -0.62
ALDOC -0.50 -0.60
AIFM3 -0.50 -0.60
CLU -0.50 -0.60
PTH1R -0.50 -0.61
LDHD -0.49 -0.59
HLA-E -0.49 -0.57
HLA-C -0.49 -0.58
PTGDS -0.48 -0.61

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005244 voltage-gated ion channel activity IEA -
GO:0005248 voltage-gated sodium channel activity TAS 7720699
GO:0031402 sodium ion binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
去:0009791 post-embryonic development IEA -
GO:0006814 sodium ion transport TAS 7720699
GO:0006811 ion transport IEA -
GO:0006954 inflammatory response IEA -
GO:0048266 behavioral response to pain IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0001518 voltage-gated sodium channel complex IEA -
GO:0016020 membrane IEA -
GO:0016021 integral to membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL DN 275 168 All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 3D UP 182 110 All SZGR 2.0 genes in this pathway
SABATES COLORECTAL ADENOMA DN 291 176 All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL UP 316 190 All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS UP 769 437 All SZGR 2.0 genes in this pathway
OKUMURA INFLAMMATORY RESPONSE LPS 183 115 All SZGR 2.0 genes in this pathway
MCCABE BOUND BY HOXC6 469 239 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway
VALK AML CLUSTER 3 33 12 All SZGR 2.0 genes in this pathway
MIKKELSEN MEF ICP WITH H3K27ME3 206 108 All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3 718 401 All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT 567 365 All SZGR 2.0 genes in this pathway
HOELZEL NF1 TARGETS UP 139 93 All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 DN 448 282 All SZGR 2.0 genes in this pathway
WARTERS RESPONSE TO IR SKIN 83 44 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY 1839 928 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-182 79 85 1A hsa-miR-182 UUUGGCAAUGGUAGAACUCACA
miR-96 79 85 1A hsa-miR-96brain UUUGGCACUAGCACAUUUUUGC