Gene Page:SCN9A
Summary?
GeneID | 6335 |
Symbol | SCN9A |
Synonyms | ETHA|FEB3B|GEFSP7|HSAN2D|NE-NA|NENA|Nav1.7|PN1|SFNP |
Description | sodium voltage-gated channel alpha subunit 9 |
Reference | MIM:603415|HGNC:HGNC:10597|Ensembl:ENSG00000169432|HPRD:04565|Vega:OTTHUMG00000154044 |
Gene type | protein-coding |
Map location | 2q24 |
Pascal p-value | 8.165E-4 |
eGene | Cortex Myers' cis & trans |
Support | EXCITABILITY |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.02395 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs17029291 | chr3 | 32402138 | SCN9A | 6335 | 0.06 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
LY6G5B | 0.68 | 0.61 |
ZNF789 | 0.68 | 0.64 |
CYP2R1 | 0.67 | 0.66 |
PBX4 | 0.67 | 0.67 |
DONSON | 0.67 | 0.64 |
ZNF311 | 0.67 | 0.67 |
FBN3 | 0.65 | 0.69 |
RANBP17 | 0.65 | 0.61 |
ZNF337 | 0.65 | 0.62 |
HPX | 0.65 | 0.52 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
FBXO2 | -0.53 | -0.61 |
HLA-F | -0.51 | -0.62 |
ALDOC | -0.50 | -0.60 |
AIFM3 | -0.50 | -0.60 |
CLU | -0.50 | -0.60 |
PTH1R | -0.50 | -0.61 |
LDHD | -0.49 | -0.59 |
HLA-E | -0.49 | -0.57 |
HLA-C | -0.49 | -0.58 |
PTGDS | -0.48 | -0.61 |
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005244 | voltage-gated ion channel activity | IEA | - | |
GO:0005248 | voltage-gated sodium channel activity | TAS | 7720699 | |
GO:0031402 | sodium ion binding | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
去:0009791 | post-embryonic development | IEA | - | |
GO:0006814 | sodium ion transport | TAS | 7720699 | |
GO:0006811 | ion transport | IEA | - | |
GO:0006954 | inflammatory response | IEA | - | |
GO:0048266 | behavioral response to pain | IEA | - | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0001518 | voltage-gated sodium channel complex | IEA | - | |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL DN | 275 | 168 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 3D UP | 182 | 110 | All SZGR 2.0 genes in this pathway |
SABATES COLORECTAL ADENOMA DN | 291 | 176 | All SZGR 2.0 genes in this pathway |
JAATINEN HEMATOPOIETIC STEM CELL UP | 316 | 190 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS UP | 769 | 437 | All SZGR 2.0 genes in this pathway |
OKUMURA INFLAMMATORY RESPONSE LPS | 183 | 115 | All SZGR 2.0 genes in this pathway |
MCCABE BOUND BY HOXC6 | 469 | 239 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
VALK AML CLUSTER 3 | 33 | 12 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF ICP WITH H3K27ME3 | 206 | 108 | All SZGR 2.0 genes in this pathway |
MIKKELSEN ES ICP WITH H3K4ME3 | 718 | 401 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
HOELZEL NF1 TARGETS UP | 139 | 93 | All SZGR 2.0 genes in this pathway |
PURBEY TARGETS OF CTBP1 NOT SATB1 DN | 448 | 282 | All SZGR 2.0 genes in this pathway |
WARTERS RESPONSE TO IR SKIN | 83 | 44 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-182 | 79 | 85 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-96 | 79 | 85 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.