Gene Page:SRR

Summary?
GeneID 63826
Symbol SRR
Synonyms ILV1|ISO1
Description serine racemase
Reference MIM:606477|HGNC:HGNC:14398|Ensembl:ENSG00000167720|HPRD: 10451|Vega:OTTHUMG00000090583
Gene type protein-coding
Map location 17p13
Pascal p-value 4.714E-8
Fetal beta 1.148
eGene Anterior cingulate cortex BA24
Caudate basal ganglia
Cerebellar Hemisphere
Cerebellum
Cortex
Frontal Cortex BA9
Hypothalamus
Myers' cis & trans
元
Support G2Cdb.humanPSD
G2Cdb.humanPSP
Potential synaptic genes

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWAScat Genome-wide Association Studies This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb.
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGC128 Genome-wide Association Study A multi-stage schizophrenia GWAS of up to 36,989 cases and 113,075 controls. Reported by the Schizophrenia Working Group of PGC. 128 independent associations spanning 108 loci
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search 系统搜索PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Association A combined odds ratio method (Sun et al. 2008), association studies 2 Link to SZGene
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias Click to show details

Section I. Genetics and epigenetics annotation

@CV:PGC128

SNP ID Chromosome Position Allele P Function Gene Up/Down Distance
rs4523957 chr17 2208899 TG 1.04E-9 intronic SRR

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs16952025 chr17 2116797 SRR 63826 0.06 cis
rs17834563 chr17 2172709 SRR 63826 0.03 cis
rs1885987 chr17 2203024 SRR 63826 0.09 cis
rs3744270 17 2207326 SRR ENSG00000167720.8 4.01456E-7 0.01 -3004 gtex_brain_ba24
rs12450028 17 2207425 SRR ENSG00000167720.8 3.91241E-7 0.01 -2905 gtex_brain_ba24
rs77530532 17 2208874 SRR ENSG00000167720.8 6.20043E-7 0.01 -1456 gtex_brain_ba24
rs116875739 17 2211001 SRR ENSG00000167720.8 1.20948E-6 0.01 671 gtex_brain_ba24

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0016853 isomerase activity IEA -
GO:0018114 threonine racemase activity IEA -
GO:0030170 pyridoxal phosphate binding IEA -
GO:0030378 serine racemase activity IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0008152 metabolic process IEA -
GO:0006563 L-serine metabolic process NAS 11054547

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG GLYCINE SERINE AND THREONINE METABOLISM 31 26 All SZGR 2.0 genes in this pathway
GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN 493 298 All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP 1278 748 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP 1142 669 All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP 612 367 All SZGR 2.0 genes in this pathway
LASTOWSKA NEUROBLASTOMA COPY NUMBER UP 181 108 All SZGR 2.0 genes in this pathway
APPIERTO RESPONSE TO FENRETINIDE UP 38 26 All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM4 261 153 All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION DN 517 309 All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 UP 256 159 All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY NO BLOOD DN 150 93 All SZGR 2.0 genes in this pathway
ULE SPLICING VIA NOVA2 43 38 All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY DN 145 88 All SZGR 2.0 genes in this pathway
ZHANG BREAST CANCER PROGENITORS DN 145 93 All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE DN 841 431 All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 DN 918 550 All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS UP 682 433 All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 DN 448 282 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-140 689 696 1A,m8 hsa-miR-140brain AGUGGUUUUACCCUAUGGUAG
miR-146 669 675 1A hsa-miR-146a UGAGAACUGAAUUCCAUGGGUU
hsa-miR-146bbrain UGAGAACUGAAUUCCAUAGGCU
miR-216 453 459 m8 hsa-miR-216 UAAUCUCAGCUGGCAACUGUG
miR-299-5p 688 694 1A hsa-miR-299-5p UGGUUUACCGUCCCACAUACAU
miR-378* 403 409 m8 hsa-miR-422b CUGGACUUGGAGUCAGAAGGCC
hsa-miR-422a CUGGACUUAGGGUCAGAAGGCC
miR-421 941 947 m8 hsa-miR-421 GGCCUCAUUAAAUGUUUGUUG