Gene Page:RBM26

Summary?
GeneID 64062
Symbol RBM26
Synonyms ARRS2|C13orf10|PPP1R132|PRO1777|SE70-2|ZC3H17
Description RNA binding motif protein 26
Reference HGNC:HGNC:20327|Ensembl:ENSG00000139746|HPRD:12611|
Gene type protein-coding
Map location 13q31.1
Pascal p-value 1.87E-4
Sherlock p-value 0.669
Fetal beta 1.109
DMG 1 (# studies)
eGene Cerebellar Hemisphere
Cerebellum
Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg12383823 13 79980322 RBM26 1.75E-10 -0.019 5.26E-7 DMG:Jaffe_2016

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs9355872 chr6 161534332 RBM26 64062 0.07 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0000166 nucleotide binding IEA -
GO:0003723 RNA binding IEA -
GO:0008270 zinc ion binding IEA -
GO:0046872 metal ion binding IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP 1382 904 All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS DN 352 225 All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER 20Q13 AMPLIFICATION DN 180 101 All SZGR 2.0 genes in this pathway
PEPPER CHRONIC LYMPHOCYTIC LEUKEMIA UP 33 28 All SZGR 2.0 genes in this pathway
HAHTOLA MYCOSIS FUNGOIDES CD4 DN 116 71 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS F UP 185 119 All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL UP 584 356 All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS UP 769 437 All SZGR 2.0 genes in this pathway
KENNY CTNNB1 TARGETS UP 50 30 All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN 911 527 All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN 1011 592 All SZGR 2.0 genes in this pathway
GRADE COLON AND RECTAL CANCER UP 285 167 All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR DN 185 116 All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 2 DN 336 211 All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 DN 918 550 All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 UP 344 215 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-129-5p 650 656 1A hsa-miR-129brain CUUUUUGCGGUCUGGGCUUGC
hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGCU
miR-137 641 647 m8 hsa-miR-137 UAUUGCUUAAGAAUACGCGUAG
miR-153 229 235 1A hsa-miR-153 UUGCAUAGUCACAAAAGUGA
miR-181 391 397 m8 hsa-miR-181abrain AACAUUCAACGCUGUCGGUGAGU
hsa-miR-181bSZ AACAUUCAUUGCUGUCGGUGGG
hsa-miR-181cbrain AACAUUCAACCUGUCGGUGAGU
hsa-miR-181dbrain AACAUUCAUUGUUGUCGGUGGGUU
miR-186 271 277 m8 hsa-miR-186 CAAAGAAUUCUCCUUUUGGGCUU
miR-196 144 150 m8 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGG
hsa-miR-196b UAGGUAGUUUCCUGUUGUUGG
miR-200bc/429 51 57 1A hsa-miR-200b UAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200c UAAUACUGCCGGGUAAUGAUGG
hsa-miR-429 UAAUACUGUCUGGUAAAACCGU
miR-369-3p 52 58 m8 hsa-miR-369-3p AAUAAUACAUGGUUGAUCUUU
miR-376c 486 492 1A hsa-miR-376c AACAUAGAGGAAAUUCCACG
miR-383 151 157 m8 hsa-miR-383brain AGAUCAGAAGGUGAUUGUGGCU
hsa-miR-383brain AGAUCAGAAGGUGAUUGUGGCU
miR-448 228 235 1A,m8 hsa-miR-448 UUGCAUAUGUAGGAUGUCCCAU
miR-485-3p 549 555 m8 hsa-miR-485-3p GUCAUACACGGCUCUCCUCUCU
miR-494 42 48 1A hsa-miR-494brain UGAAACAUACACGGGAAACCUCUU
miR-543 392 398 m8 hsa-miR-543 AAACAUUCGCGGUGCACUUCU