Gene Page:FBRS

Summary?
GeneID 64319
Symbol FBRS
Synonyms FBS|FBS1
Description fibrosin
Reference MIM:608601|HGNC:HGNC:20442|Ensembl:ENSG00000156860|HPRD:16354|Vega:OTTHUMG00000132390
Gene type protein-coding
Map location 16p11.2
Pascal p-value 0.093
Sherlock p-value 0.004
Fetal beta -0.572
DMG 1 (# studies)

Gene in Data Sources
Gene set name Method of gene set Description Info
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 2
GSMA_IIE Genome scan meta-analysis (European-ancestry samples) Psr: 0.01775

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg01566527 16 30669819 FBRS 4.61E-9 -0.008 2.69E-6 DMG:Jaffe_2016
cg04342090 16 30670571 FBRS 2.71E-8 -0.008 8.56E-6 DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
RASHI RESPONSE TO IONIZING RADIATION 3 48 31 All SZGR 2.0 genes in this pathway
LIN APC TARGETS 77 55 All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED 1022 619 All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED 1229 713 All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP 871 505 All SZGR 2.0 genes in this pathway
MOOTHA PGC 420 269 All SZGR 2.0 genes in this pathway
SHEDDEN肺癌A5生存良好 70 32 All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SUBCLASS S1 237 159 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP B 549 316 All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE MIDDLE 98 56 All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE VIA P38 COMPLETE 227 151 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-141/200a 1151 1157 1A hsa-miR-141 UAACACUGUCUGGUAAAGAUGG
hsa-miR-200a UAACACUGUCUGGUAACGAUGU
miR-149 340 346 1A hsa-miR-149brain UCUGGCUCCGUGUCUUCACUCC
miR-194 1153 1159 1A hsa-miR-194 UGUAACAGCAACUCCAUGUGGA
miR-22 975 981 m8 hsa-miR-22brain AAGCUGCCAGUUGAAGAACUGU
miR-29 543 549 m8 hsa-miR-29aSZ UAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZ UAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZ UAGCACCAUUUGAAAUCGGU
miR-370 1023 1029 m8 hsa-miR-370brain GCCUGCUGGGGUGGAACCUGG
miR-410 1138 1144 1A hsa-miR-410 AAUAUAACACAGAUGGCCUGU
miR-493-5p 437 443 m8 hsa-miR-493-5p UUGUACAUGGUAGGCUUUCAUU
miR-9 938 945 1A,m8 hsa-miR-9SZ UCUUUGGUUAUCUAGCUGUAUGA