Gene Page:CHST8

Summary?
GeneID 64377
Symbol CHST8
Synonyms GALNAC4ST1|GalNAc4ST|PSS3
Description carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8
Reference MIM:610190|HGNC:HGNC:15993|Ensembl:ENSG00000124302|HPRD:07632|Vega:OTTHUMG00000180472
Gene type protein-coding
Map location 19q13.1
Pascal p-value 0.452
Fetal beta -1.243
DMG 1 (# studies)
eGene Caudate basal ganglia

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWAScat Genome-wide Association Studies This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb.
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
PMID:cooccur High-throughput literature-search 系统搜索PubMed的genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg08135503 19 34177741 CHST8 3.273E-4 0.491 0.04 DMG:Wockner_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0001537 N-acetylgalactosamine 4-O-sulfotransferase activity IDA 10988300|11001942|11445554
GO:0016740 transferase activity IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007417 central nervous system development NAS Brain (GO term level: 6) 10988300
GO:0005975 carbohydrate metabolic process IEA -
GO:0042446 hormone biosynthetic process IEP 10988300
GO:0030166 proteoglycan biosynthetic process IDA 10988300
GO:0006790 sulfur metabolic process IDA 11445554
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0000139 Golgi membrane IEA -
GO:0005794 Golgi apparatus IEA -
GO:0016020 membrane IEA -
GO:0016021 integral to membrane NAS 10988300

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
DAVICIONI MOLECULAR ARMS VS ERMS UP 332 228 All SZGR 2.0 genes in this pathway
PEPPER CHRONIC LYMPHOCYTIC LEUKEMIA DN 21 8 All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038 678 All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062 725 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652 441 All SZGR 2.0 genes in this pathway
RIGGINS TAMOXIFEN RESISTANCE UP 66 44 All SZGR 2.0 genes in this pathway
WANG LSD1 TARGETS DN 39 30 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN BRAIN DN 85 58 All SZGR 2.0 genes in this pathway
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING 510 309 All SZGR 2.0 genes in this pathway
GRADE COLON AND RECTAL CANCER DN 101 65 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME3 AND H3K27ME3 142 103 All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069 729 All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3 210 148 All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE UP 857 456 All SZGR 2.0 genes in this pathway
PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 DN 157 106 All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS NOT VIA AKT1 UP 211 131 All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS VIA AKT1 UP 281 183 All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D 658 397 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-218 426 432 m8 hsa-miR-218brain UUGUGCUUGAUCUAACCAUGU