Gene Page:SH3GL3

Summary?
GeneID 6457
Symbol SH3GL3
Synonyms CNSA3|EEN-B2|HsT19371|SH3D2C|SH3P13
Description SH3-domain GRB2-like 3
Reference MIM:603362|HGNC:HGNC:10832|Ensembl:ENSG00000140600|HPRD:04528|Vega:OTTHUMG00000147361
Gene type protein-coding
Map location 15q24
Pascal p-value 2.666E-4
Sherlock p-value 0.95
Fetal beta -0.225

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
CV:PheWAS Phenome-wide association studies (PheWAS) 157 SNPs associated with schizophrenia 1
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 0.0594

Section I. Genetics and epigenetics annotation

@CV:PheWAS

SNP ID Chromosome Position Allele P Function Gene Up/Down Distance
rs2562784 15 84286492 null 1.674 SH3GL3 null


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13- 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005515 protein binding IEA -
GO:0008289 lipid binding IEA -
GO:0042802 identical protein binding 新闻学会 16115810
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007417 central nervous system development TAS Brain (GO term level: 6) 9169142
GO:0007165 signal transduction TAS 9169142
GO:0006897 endocytosis IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005737 cytoplasm IEA -
GO:0005768 endosome IEA -
GO:0016020 membrane IEA -
GO:0031901 early endosome membrane IEA -

Section IV. Protein-protein interaction annotation

扶少团团员 Aliases B Official full name B Experimental Source PubMed ID
ADRB1 ADRB1R | B1AR | BETA1AR | RHR adrenergic, beta-1-, receptor Beta-1-AR interacts with SH3p13. This interaction was modeled on a demonstrated interaction between human Beta-1-AR and rat SH3p13. BIND 10535961
AES AES-1 | AES-2 | ESP1 | GRG | GRG5 | TLE5 amino-terminal enhancer of split Two-hybrid BioGRID 16169070
ARHGDIA GDIA1 | MGC117248 | RHOGDI | RHOGDI-1 Rho GDP dissociation inhibitor (GDI) alpha Two-hybrid BioGRID 16169070
C11orf68 BLES03 | P5326 chromosome 11 open reading frame 68 Two-hybrid BioGRID 16169070
C4orf17 DKFZp434G072 chromosome 4 open reading frame 17 Two-hybrid BioGRID 16169070
CALCOCO1 Cocoa | KIAA1536 | PP13275 | calphoglin calcium binding and coiled-coil domain 1 Two-hybrid BioGRID 16169070
CBL C-CBL | CBL2 | RNF55 Cas-Br-M (murine) ecotropic retroviral transforming sequence - HPRD,BioGRID 11894096
CRIP1 CRHP | CRIP | CRP1 | FLJ40971 cysteine-rich protein 1 (intestinal) Two-hybrid BioGRID 16169070
DNM1 DNM dynamin 1 Endophilin A3 interacts with Dynamin. BIND 11894096
DNM1 DNM dynamin 1 - HPRD 9238017
DPPA4 2410091M23Rik | FLJ10713 developmental pluripotency associated 4 Two-hybrid BioGRID 16169070
DPYSL4 CRMP3 | DRP-4 | ULIP4 dihydropyrimidinase-like 4 Two-hybrid BioGRID 16169070
EGFL6 DKFZp564P2063 | MAEG | W80 EGF-like-domain, multiple 6 Two-hybrid BioGRID 16169070
EMD EDMD | LEMD5 | STA emerin Two-hybrid BioGRID 16169070
FAM173A C16orf24 | MGC2494 family with sequence similarity 173, member A Two-hybrid BioGRID 16169070
GABBR2 FLJ36928 | GABABR2 | GPR51 | GPRC3B | HG20 | HRIHFB2099 gamma-aminobutyric acid (GABA) B receptor, 2 Two-hybrid BioGRID 16169070
HTT 高清| IT15 huntingtin HD interacts with SH3GL3. BIND 9809064
HTT 高清| IT15 huntingtin - HPRD,BioGRID 9809064
IGSF2 CD101 | V7 immunoglobulin superfamily, member 2 Two-hybrid BioGRID 16169070
NDUFB9 B22 | DKFZp566O173 | FLJ22885 | LYRM3 | UQOR22 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa Two-hybrid BioGRID 16169070
PDCD6IP AIP1 | Alix | DRIP4 | HP95 | MGC17003 programmed cell death 6 interacting protein - HPRD 12034747
QTRT1 FP3235 | TGT queuine tRNA-ribosyltransferase 1 Two-hybrid BioGRID 16169070
RER1 - RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae) Two-hybrid BioGRID 16169070
RPL35A - ribosomal protein L35a Two-hybrid BioGRID 16169070
SH3D19 EBP | EVE1 | Kryn | MGC105136 | MGC118910 | MGC118911 | MGC118912 | MGC118913 | SH3P19 SH3 domain containing 19 - HPRD 14551139
SH3GL1 CNSA1 | EEN | MGC111371 | SH3D2B | SH3P8 SH3-domain GRB2-like 1 Two-hybrid BioGRID 16169070
SH3KBP1 CIN85 | GIG10 | MIG18 SH3-domain kinase binding protein 1 Endophilin A3 interacts with CIN85. BIND 11894096
SH3KBP1 CIN85 | GIG10 | MIG18 SH3-domain kinase binding protein 1 Affinity Capture-Western
Reconstituted Complex
Two-hybrid		 BioGRID 11894096
SNRPN DKFZp686C0927 | DKFZp686M12165 | DKFZp761I1912 | DKFZp762N022 | FLJ33569 | FLJ36996 | FLJ39265 | HCERN3 | MGC29886 | PWCR | RT-LI | SM-D | SMN | SNRNP-N | SNURF-SNRPN small nuclear ribonucleoprotein polypeptide N Two-hybrid BioGRID 16169070
TERF1 FLJ41416 | PIN2 | TRBF1 | TRF | TRF1 | hTRF1-AS | t-TRF1 telomeric repeat binding factor (NIMA-interacting) 1 Two-hybrid BioGRID 16169070
TOE1 FLJ13949 target of EGR1, member 1 (nuclear) Two-hybrid BioGRID 16169070
WDR33 FLJ11294 | WDC146 WD repeat domain 33 Two-hybrid BioGRID 16169070


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG ENDOCYTOSIS 183 132 All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP 1278 748 All SZGR 2.0 genes in this pathway
ELVIDGE HYPOXIA UP 171 112 All SZGR 2.0 genes in this pathway
ELVIDGE HIF1A TARGETS DN 91 58 All SZGR 2.0 genes in this pathway
ELVIDGE HIF1A AND HIF2A TARGETS DN 104 72 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821 933 All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS F DN 33 24 All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL DN 186 107 All SZGR 2.0 genes in this pathway
RASHI RESPONSE TO IONIZING RADIATION 5 147 89 All SZGR 2.0 genes in this pathway
MATTIOLI MGUS VS PCL 116 62 All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM1 229 137 All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS 734 436 All SZGR 2.0 genes in this pathway
LE EGR2 TARGETS UP 108 75 All SZGR 2.0 genes in this pathway
GERY CEBP TARGETS 126 90 All SZGR 2.0 genes in this pathway
MCCLUNG COCAINE REWARD 5D 79 62 All SZGR 2.0 genes in this pathway
KAYO AGING MUSCLE UP 244 165 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 1691 1088 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 18HR UP 178 111 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 24HR UP 148 96 All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS UP 317 208 All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS SILENCED BY METHYLATION UP 461 298 All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR UP 430 288 All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER GOOD SURVIVAL A12 317 177 All SZGR 2.0 genes in this pathway
开罗肝脏发展起来 166 105 All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA NEURAL 129 85 All SZGR 2.0 genes in this pathway
LU EZH2 TARGETS UP 295 155 All SZGR 2.0 genes in this pathway
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS UP 259 159 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-142-5p 128 134 1A hsa-miR-142-5p CAUAAAGUAGAAAGCACUAC
miR-27 415 421 1A hsa-miR-27abrain UUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrain UUCACAGUGGCUAAGUUCUGC
miR-30-3p 34 40 m8 hsa-miR-30a-3p CUUUCAGUCGGAUGUUUGCAGC
hsa-miR-30e-3p CUUUCAGUCGGAUGUUUACAGC
miR-381 157 163 1A hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU